sEx12009 [rCes ZK265.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

raEx200 [T05G5.1pZK265.6(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

ZK265.1 Homozygous. Outer Left Sequence: ttgctcaacatcatgcccta. Outer Right Sequence: aatggcggaagtatctgtgg. Inner Left Sequence: tcgaaaatcccaattcaacc. Inner Right Sequence: gagccgatgttttcaagctc. Inner Primer PCR Length: 2972. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 6749 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cgtttgtctccttttctccaagccccgccc ; Right flanking sequence: ACTGGTAGCACTTCCCTTCTCGTTTCTGTA. sgRNA #3: tgagctgtctcacaagtggg; sgRNA #4: AGTGATTTTGAAAACTCTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

ZK265. External left primer: ATTTTGGCGCATATCTCACC. External right primer: AGGGTGCGATTAACGTTTTG. Internal left primer: GCGTTGGTAGGTTGTGTTGA. Internal right primer: GCACTCTGCGGGATTTCTAC. Internal WT amplicon: 2020 bp. Deletion size: 275 bp. Deletion left flank: AAACACAGCGTCTCTTAGAGGCATTTATGT. Deletion right flank: TGTTTTGGCACGCGGCACCTCCAACACAAA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3042) in ZK265, detectable by PCR using the following primers. External left primer: ATTTTGGCGCATATCTCACC. External right primer: AGGGTGCGATTAACGTTTTG. Internal left primer: GCGTTGGTAGGTTGTGTTGA. Internal right primer: GCACTCTGCGGGATTTCTAC. Internal WT amplicon: 2020 bp. Deletion size: 1123 bp. Deletion left flank: AAGAAGAACTGTGTGATGGGAAGCAGCAAA. Deletion right flank: AGACACTTGTGGATTCCTCGAGAAAAAGTG. Validation: No CGH probes for gk3042. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807