More Fields
Strain Species Genotype
RG3141 C. elegans +/mT1[umnIs52] II; popl-5(ve641[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 2064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve641 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: caatgcgcctacatgcctacctacatgcca ; Right flanking sequence: AGGCTCATTTTCAAAATAGAATATCCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
UDN100194 C. elegans popl-5(udn113)/tmC29 [unc-49(tmIs1259)] III. Show Description
popl-5 [S99I]/tmC29 III. Variant edit. Lethal mutation balanced by tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99I] homozygotes (larval lethal), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn113 homozygotes are partially L3 laval lethal: some homozygotes can develop into sterile adults with protruding vulvae. Pick fertile GFP+ to maintain. AvaII site added in S99I allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658
UDN100215 C. elegans popl-5(udn109)/tmC29 [unc-49(tmIs1259)] III. Show Description
popl-5 [S99S]/tmC29 III. Control edit mutation maintained over tmC29. Balancer marked with myo-2p::GFP. Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP popl-5 [S99S] homozygotes (viable and fertile), and Unc GFP+ tmC29 homozygotes. Pick fertile wild-type GFP+ to maintain. NOTE: udn109 is essentially wild-type. Pick GFP+ to prevent non-GFP popl-5 [S99S] homozygotes from taking over the population and losing the balancer! Silent AvaII site added in S99S allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658