More Fields
Strain Species Genotype
AC68 C. elegans unc-29(e1072) aph-2(zu181)/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are WT and segregate WT, Unc Egls, and dead eggs.
AUM1535 C. elegans drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Show Description
[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.
BA671 C. elegans spe-9(hc88) I. Show Description
Self-sterile at 25C. Maintain at 15C.
BA714 C. elegans sDf5/spe-4(hc78) I. Show Description
Heterozygotes are WT and segregate WT heterozygotes, Sterile spe-4 homozygotes, and dead eggs (sDf5 homozygotes).
BA811 C. elegans sDf5/spe-4(hc78) unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT heterozygotes, Sterile Unc spe-4 unc-15 homozygotes, and dead eggs (sDf5 homozygotes). Pick wild-type to maintain.
BC18 C. elegans unc-22(s13) IV. Show Description
Twitcher Unc. Heterozygotes twitch in 1% Nicotine. Recessive.
BE38 C. elegans dpy-2(sc38) II. Show Description
Temperature sensitive. Left hand Roller and Dpy at 25C. Dpyish at 16C. Recessive.
BE98 C. elegans rol-8(sc98) II. Show Description
Adults left-handed rollers.
CB15 C. elegans unc-8(e15) IV. Show Description
Unc.
CB398 C. elegans mec-8(e398) I. Show Description
Slightly Dpy. Sluggish. Recessive. Mechanosensory abnormal. M-MATING++ 1-10%WT.
CB49 C. elegans unc-8(e49) IV. Show Description
Unc.
CGC18 C. elegans umnIs7 III. Show Description
umnIs7 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC28 C. elegans +/szT1 [lon-2(e678) umnIs17] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs17 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC38 C. elegans umnIs27 III. Show Description
umnIs27 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC48 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.
CGC58 C. elegans C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC68 C. elegans mT1/unc-4(e120) II; mT1 [dpy-10(e128) umnIs54]/dpy-17(e164) III. Show Description
umnIs54 [myo-2p::GFP + NeoR, III: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-mGFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC78 C. elegans C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC88 C. elegans tmIn26 [umnIs70] X. Show Description
umnIs70 [myo-2p::GFP + NeoR, X:6745526(intergenic)] X. tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. Derived by insertion of myo-2p::GFP transgene into parental strain FX19171 using CRISPR/Cas9.
CT8 C. elegans lin-41(ma104) I. Show Description
Dpy. Precocious heterochronic. Reduced brood size. There may be a linked Dpy mutation in this strain.
DR439 C. elegans unc-8(e49) dpy-20(e1282) IV. Show Description
DpyUnc.
DR442 C. elegans unc-8(e49) daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Unc.
DR641 C. elegans ama-1(m118m221) unc-8(e15)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Unc and segregate semi-Unc and Vul and dead eggs. (Does not segregate Unc homozygotes because linked to the unc is a lethal in the amanitin gene.)
DR645 C. elegans ama-1(m118) unc-8(e15) IV. Show Description
EU3115 C elegans klp-15(ok1958) klp-16(or1952)/tmC18[dpy-5(tmIs1236)] I; ltIs37 IV; ruIs57. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3201 C elegans klp-15(ok1958) aspm-1(syb1260[gfp::aspm-1]) klp-16(or1952) /tmC18[dpy-5(tmIs1236)] I; ltIs37[pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU592 C. elegans unc-8(n491) zen-4(or153) IV. Show Description
Temperature sensitive. Grow at permissive temperature of 15C. Fully penetrant cytokinesis defect at the restrictive temperature of 25C. Semi-dominant Unc.
FT1310 C. elegans avr-14(ad1302) I; xnSi31 II; unc-119 (ed3) III; glc-1(pk54::Tc1) avr-15(ad1051) V. Show Description
xnSi31 [sec-8::mCherry + unc-119(+)] II. Expresses sec-8::mCherry maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
FX30166 C. elegans tmC18 I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30167 C. elegans tmC18 [dpy-5(tmIs1200)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30168 C. elegans tmC18 [dpy-5(tmIs1236)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30197 C. elegans tmC25 IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) One breakpoint is in unc-8, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30203 C. elegans tmC25 [unc-5(tmIs1241)] IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30238 C. elegans tmC18 [dpy-5(tm9705)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30257 C. elegans tmC25 [unc-5(tm9708)] IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
GH534 C. elegans mrp-4(cd8) X. Show Description
WT strain. cd8 will suppress the embryonic and larval lethality of cup-5(zu223).
HC48 C. elegans tbb-2(qt1) III. Show Description
Temperature sensitive embryonic lethal mutation with defects in centration and rotation of the centrosome pronuclear complex in the first cell division. Maintain at 15C.
JH2730 C. elegans unc-119(ed3) III; axIs1895. Show Description
axIs1895 [pie-1p::GFP::H2B::rec-8 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.
JK1534 C. elegans ces-1(n703) qDf5/unc-29(e193) mec-8(e398) blmp-1(s71) I. Show Description
Heterozygotes are Ces and grow slowly. Hets segregate DpyUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1561 C. elegans ces-1(n703) qDf15/unc-29(e193) mec-8(e398) lin-11(n566) I. Show Description
Heterozygotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JT200 C. elegans unc-43(sa200) IV. Show Description
Defecation motor program executed twice each cycle period. Hyperactive loopy movement. Previously called dec-8(sa200).
KG115 C. elegans lin-1(e1275) unc-33(e204)/ric-8(ok98) IV. Show Description
ok98/+ animals are slightly Egl-d and have a small vulval bump. ok98 homozygotes are straight and paralyzed and slow growing. About 2/3 eventually reach adulthood and are paralyzed and sterile (they produce few if any oocytes). Segregates Unc Muv(ts).
KG744 C. elegans pde-4(ce268) II. Show Description
Hyperactive locomotion and hypersensitive to stimuli such as plate dropping. Restores wild type levels of locomotion to paralyzed ric-8(md303) mutants. Most, but not all adults, appear significantly Egl-c. Some mature adults are thinner than normal. Aldicarb sensitivity, growth rate, pumping, length, and distribution on food are all similar to wild type. The ce268 mutation is a D448N change relative to PDE-4D isoform. It disrupts the catalytic domain by changing one of the four active site residues that together chelate an active site zinc atom. Inheritance is semi-dominant due to dominant negative side effects.
LKC28 C. brenneri Show Description
Male-female strain. Isolated in 2003 by Lynn Carta from material which was intercepted by Hernan Ruiz, a Plant Pathologist at Miami Inspection Station of USDA-APHIS-PPQ. The nematodes came from Liriope roots grown in the nursery Liriope de Costa Rica, La Gloria de Aguas Zarcas, Vereda Turrucares, Provincia de Alajuela, Costa Rica, Central America. The strain is conspecific with CB5161 based on mating tests. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.
LSC68 C. elegans pdfr-1(lst34) III; lstEx117. Show Description
lstEx117 [unc-119p::pdfr-1b::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1b isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.
MC896 C. elegans nol-10(gc58) IV. Show Description
Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.
MH2294 C. elegans scc-3(ku263)/lin-25(n545) V. Show Description
Heterozygotes are WT and segregate WT, lin-25 homozygotes (which are temperature sensitive: at 25C adult hermaphrodites are vulvaless, at 15C 8% of adult hermaphrodites are vulvaless), and scc-3 homozygotes which are Pvl and Sterile (vulval morphogenesis defects and defects in sister-chromatin cohesion).
MJ58 C. elegans emb-2(hc58) III. Show Description
ts egg lethal. Will grow at 15C and 20C. Will not grow at 25C.
ML2482 C.elegans noah-1(mc68[noah-1::mCherry]) I. Show Description
Superficially wild-type. Endogenous noah-1 locus tagged with mCherry. Reference: Vuong-Brender TTK, et al. Development. 2017 May 19. pii: dev.150383.
ML732 C. elegans vha-5(mc38)/unc-24(e138) dpy-20(e1282) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).