sEx11090 [rCes ZK512.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12881 [rCes ZK512.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13603[rCesZK512.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

ZK512.6, ZK512.7. Homozygous. Outer Left Sequence: ACAAATGGTTGGAGAGCCAC. Outer Right Sequence: ATGCAGCTTCTCCTCCAAAA. Inner Left Sequence: AGCCCAACACAACAAAAAGG. Inner Right Sequence: GGATCTTGTTGGATCGGAGA. Inner Primer PCR Length: 3386 bp. Deletion Size: 1329 bp. Deletion left flank: TACAGCACTCTTTTTTCAGGGAGTTTGTTA. Deletion right flank: GTGCTAAAATGCCTGAATATCGTAGTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygous strain, might not be homozygous viable. Deletion of 2129 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGGCCTTTCTCTTCAAAGCCTTCTTCTCCT; Right flanking sequence: CTATGCTTTTTCTTGTATATTTCAAACATT. sgRNA #1: TGGAACTGGTAGAAAAGCAG; sgRNA #2: CATAAAATGGGTCAGAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.