Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
DE112 C. elegans sup-46(qa710) I; dnSi4 II; unc-119(ed9) III. Show Description
dnSi4 [gna-1::GFP::gna-1 3Â’UTR + Cbr-unc-119(+)] inserted into ttTi5605 on LG II. Unknown if unc-119(ed9) III is homozygous or heterozygous in this strain.
VH7001 C. elegans gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Deletion of 439 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTAACGTGTGAAATTTAGAAGCGCTGAG; Right flanking sequence: AGGAATGTGTGGAGCTAACACAGACGCATC. sgRNA #1: TCATAAAATTGCAATCGTCC; sgRNA #2: AAATTGTCAGGAAGATTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.