Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
TV27051 C. elegans wyIs592 III; mec-4(e1611) X. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. mec-4(e1611) is a gain of function point mutation. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
TV29856 C. elegans kpc-1(gk8) I; wyIs592 III. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. gk8 is a punitive null allele of kpc-1. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
TV775 C. elegans wyIs58 III. Show Description
wyIs58 [opt-3::GFP::RAB-3 + unc-122p::RFP] III. Reference: Wang J, et al. Science. 2010 Jul 16;329(5989):293.
UJ1300 C. elegans unc-9(miz81[unc-9::7xGFP11]) X; juIs463. Show Description
juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. 7xGFP11 tag inserted into endogenous unc-9 locus. unc-9(miz81) is Unc, possibly due to increased channel activity. Reference: Hendi A, et al. Elife. 2022 Nov 15;11:e80555. doi: 10.7554/eLife.80555. PMID: 36378164.
UTR133 C. elegans narSi2 II; mpk-1(ga117) III; narEx29. Show Description
narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. narEx29 [sur-5p::GFP::mpk-1A + myo-3p::RFP]. mpk-1(-) strain with germline MPK-1B rescued by single-copy insertion and somatic MPK-1A rescued by an extrachromosomal array. Pick RFP+ to maintain; narEx29 rescues mpk-1 so array should be stable. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
VC370 C. elegans rfp-1(ok572)/eT1 III; +/eT1 V. Show Description
R05D3.4. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok572 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4098 C. elegans hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Show Description
Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VK2757 C. elegans vkEx2757. Show Description
vkEx2757 [nhx-2p::CemNeptune2.5 + myo-2p::RFP]. Wild-type animals expressing CemNeptune2.5 under the intestinal-specific nhx-2 promoter. Free CemNeptune2.5 is localized to the cytosol. Pick animals with RFP+ pharynx to maintain. Reference: Thomas
VP596 C. elegans dvIs19 III; vsIs33 V. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).
VS10 C. elegans hjIs37. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. mRFP targeted to peroxisomes in intestinal cells. Reference: Zhang et al., PNAS (2010) 107(10):4640-5.
VS20 C. elegans hjIs67. Show Description
hjIs67 [atgl-1p::atgl-1::GFP + mec-7::RFP]. GFP expression is not detectable at low magnification. Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VZ454 C. elegans gsr-1(tm3574)/qC1 dpy-19(e1259) glp-1(q339) nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.
WEN1 C. elegans wenIs1. Show Description
wenIs1 [acr-5p::Arch::wCherry + lin-15(+)]. RFP expression in B motor neurons. Strain allows optogenetic inactivation of B motor neurons. Reference: Xu T, et al. Proc Natl Acad Sci USA. 2018 May 8;115(19):E4493-E4502. doi: 10.1073/pnas.1717022115. PMID: 29686107.
WM186 C. elegans avr-14(ad1302) I; ttTi5605 II; unc-119(ed3) III; avr-15(ad1051) glc-1(pk54) V; neEx15. Show Description
neEx15 [myo-2::RFP + myo-2::avr-15(+) + unc-119(+)]. MosSCI recipient strain. neEx15 rescues unc-119, making the worms healthier for injection. The array is counter-selectable. Reference: Shirayama M, et al. Cell. 2012 Jul 6;150(1):65-77.
XE1935 C. elegans wpIs98 I. Show Description
wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. Chrimson is expressed in DA9. Use 100 uM ATR in OP50 for optogenetic experiments. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.
XE1995 C. elegans wpIs98 I; ric-7(n2657) V; wpIs103. Show Description
wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. wpIs103 [myo-3p::GCaMP6 + myo-2p::mCherry].  ric-7 causes defective expulsion during defecation and slightly slow growth. Chrimson is expressed in DA9. GCaMP6 expressed in body wall muscles. Use 100 uM ATR in OP50 for optogenetic experiments. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.
XE2043 C. elegans wpIs98 unc-13(e51) I; ric-7(n2657) V. Show Description
wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.
XE2045 C. elegans ric-7(n2657) V; ufIs92wpIs109. Show Description
ufIs92 [unc-47p::acr-12::GFP].  wpIs109 [itr-1pB::mCherry + odr-1p::RFP]. ric-7 causes defective expulsion during defecation and slightly slow growth. ACR-12::GFP expression in GABA neurons. DA9 is labeled with mCherry. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.
XE2263 C. elegans oyIs14 V; wpEx369. Show Description
oyIs14 [sra-6p::GFP] V. wpEx369 [sra-6p::mito::TagRFP + odr-1p::RFP]. Maintain by picking animals with red fluorescence. PVQ neurons are marked with integrated GFP marker. Mitochondria in PVQ neurons are visualized with sra-6p::mito::TagRFP. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. doi: 10.7554/eLife.73557. PMID: 35285800.
XE2789 C. elegans pha-1(e2123) III; ccIs4595 IV; wpEx482. Show Description
ccIs4595 [ceh-24::GFP + rol-6(su1006)]. wpEx482 [ceh-17::NLS::TagRFP + pha-1(+)]. Maintain at 25C to retain array. GFP expression in vulval muscles, m8, and set of neurons in the head. The four SIA neurons are marked with both GFP and RFP. Can be used to isolate SIA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
XE3106 C. elegans pha-1(e2123) III; otIs707; wpEx525. Show Description
otIs707 [bnc-1p(1.8kb)::GFP]. wpEx525 [nlp-38p::NLS::TagRFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. GFP expression in VA neurons can be used to isolate VA by FACS (exclude TagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
YY1446 C. elegans znfx-1(gg634[HA::tagRFP::znfx-1]) II. Show Description
HA::tagRFP inserted into endogenous znfx-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY1492 C. elegans mut-16(cmp3[mut-16::gfp::flag + loxP] I; znfx-1(gg634[HA::tagRFP::znfx-1]) II; pgl-1(gg640[pgl-1::3xflag::mCardinal]) IV. Show Description
gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY968 C. elegans znfx-1(gg544[3xflag::gfp::znfx-1]) II; pgl-1(gg547[pgl-1::3xflag::tagRFP]) IV. Show Description
3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
ZM10040 C. elegans hpIs721. Show Description
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. Transgenic animals have pharyngeal RFP expression and SNB-1::GFP expression in AVA (soma and along the VNC).
ZM10113 C. elegans twk-40(bln282[twk-40::TagRFP::ZF1]) III; hpIs727. Show Description
hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated allele of the endogenous twk-40 locus, inserting TagRFP and ZF1 allowing visualization of endogenous protein expression and localization as well as ZIF-1-mediated degradation. hpIs727 provides AVA neuron-specific expression of ZIF-1, leading to depletion of TWK-40 from AVA. Animals have loopy forward and reversal movements compared to twk-40(bln282) alone.
ZM10176 C. elegans unc-25(e156) III; hpIs593; ljIs131. Show Description
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10281 C. elegans hpIs740. Show Description
hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10311 C. elegans unc-25(e156) III; ljIs131; hpIs758. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10339 C. elegans hpIs717; ljIs131. Show Description
hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10355 C.elegans twk-40(bln282[twk-40::TagRFP::ZF1]) III; hpEx4120. Show Description
hpEx4120 [rgef-1p::GPI::YFP]. Pick YFP+ animals to maintain. TagRFP::ZF1 tag inserted into endogenous twk-40 locus.
ZM10410 C. elegans gbb-2(tm1165) IV; hpIs593; ljIs131. Show Description
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neurons are marked with red fluorescence. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10441 C. elegans unc-49(e407) III; hpIs592; ljIs131. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10484 C. elegans unc-25(e156) III; hpIs321; hpIs331; ljIs131. Show Description
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Dorsal-coiler in L1, kinker in Adult after 1 hr illumination with blue light. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10538 C. elegans hpIs774; hpEx4081. Show Description
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVB’s calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system).
ZM10743 C. elegans unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10767 C. elegans hpIs819. Show Description
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. Cytoplasmic GFP and nuclear RFP in AVA, AVE, AVB and some neurons in RVG, and tail (DVA).
ZM10786 C. elegans hpIs721; hpIs811. Show Description
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite.
ZM10829 C. elegans hpEx4271. Show Description
hpEx4271 [gbb-2(fosmid)::GFP + myo-2p::RFP]. Pick animals with red fluorescence to maintain. GBB-2::GFP expression in muscles and neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM11006 C. elegans ljIs131; hpEx4340. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.
ZM11020 C. elegans ljIs131; hpEx4343. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.
ZM11034 C. elegans hpIs819; hpIs810. Show Description
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. hpIs810 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Transgenic animals exhibit strong RFP signals in AVA soma and neurites; cytoplasmic GFP and RFP in AVA, AVE, AVB and some neurons in RVG and tail (DVA).
ZM11151 C. elegans hpIs758; hpIs814. Show Description
hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min.
ZM2246 C. elegans hpIs88. Show Description
hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM7054 C. elegans hpIs321. Show Description
hpIs321 [nmr-1p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neurons ablation (AVA/AVE/AVD/others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM7212 C. elegans unc-77(gk9); nca-2(gk5); hpIs166; hpEx3088. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3088 [rgef-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7297 C. elegans hpIs331. Show Description
hpIs331 [lgc55Bp::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation (AVB & others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM7419 C. elegans hpIs363. Show Description
hpIs363 [sra-11p::ChR2::YFP + ttx-3p::RFP]. YFP expression in AVA. RFP expression in AIY. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM7465 C. elegans hpIs321; hpIs331; ljIs131. Show Description
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM7656 C. elegans hpIs365. Show Description
hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).