Search Strains

Y39A3CL.5 Homozygous. Outer Left Sequence: cttttggtttttgcggagtc. Outer Right Sequence: caaggcgggacttgattaaa. Inner Left Sequence: cagggatcactggagccac. Inner Right Sequence: tcgaaaaatttcgggaaaaa. Inner Primer PCR Length: 1206. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.2. Homozygous. Outer Left Sequence: ATGTGTGTGCTGCAAGAAGG. Outer Right Sequence: CGGAACGTCGCCTATAAAAA. Inner Left Sequence: GGTATTCAATCGCAGCGG. Inner Right Sequence: ATTCGGTTTGTCATCGCACT. Inner Primer PCR Length: 1325 bp. Deletion Size: 1048 bp. Deletion left flank: GACGTTGCTAACTGTGTTAATGCGTGTTTC. Deletion right flank: ATAATATTTCCTAAATTCTCTCATCTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y4C6A.1. Homozygous. Outer Left Sequence: GAAAACTCCAAACGGGACAA. Outer Right Sequence: ATTCGGCATACCTTCAAACG. Inner Left Sequence: AAATCAAAAGCCGTTCGTG. Inner Right Sequence: CCCCAACTGAAAATGGCTTA. Inner Primer PCR Length: 1236 bp. Deletion Size: 408 bp. Deletion left flank: CTGTTCAAGTGCAACTTTTCAACTTCTGAA. Deletion right flank: CTGTATTCATCGGTTCGTTTTCTTAAAAAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12D9.1. Homozygous. Outer Left Sequence: TAATGTGGTCCGCACAAAAA. Outer Right Sequence: GAGCAAAGTTGCGATTGTGA. Inner Left Sequence: TTTACTTGTGCATTTTTCCCA. Inner Right Sequence: TAGCGCAGCGTAGTTGGATA. Inner Primer PCR Length: 1192 bp. Deletion Size: 543 bp. Deletion left flank: ACGCGGCCACATTCTTCCCAGTCACGTTTT. Deletion right flank: TTTCAGATGCTGTAATTAGGATTTAGTTGA. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39G8B.3. Homozygous. Outer Left Sequence: AGGTGCACACCTTTTTGCAT. Outer Right Sequence: ACCTTTTGGAAAAATTGCGA. Inner Left Sequence: AGCGACTGGGTGAAACAGAA. Inner Right Sequence: GCACCTGAATAATGCGAAAAA. Inner Primer PCR Length: 1272 bp. Deletion Size: 508 bp. Deletion left flank: GTCTCTGTCTCCTTTTTCAGCTCTTCGCAC. Deletion right flank: AGAATTTTCTAGAATTTTCCAAAAGGTTTC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59A3.10 Homozygous. Outer Left Sequence: ttgccgaaaataagtttgcc. Outer Right Sequence: ttagtgtcgtcagtggggaa. Inner Left Sequence: acggctatttcctctgaacg. Inner Right Sequence: tcaaaatgggtcaaaaagaaaaa. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK643.3. Homozygous. Outer Left Sequence: AACTCGCAAAGCTCCAAAAA. Outer Right Sequence: TCGCTTCAAGACCCAGTACC. Inner Left Sequence: CTATTCTAACGGCTCGCCAA. Inner Right Sequence: CCGATCCATTTCAATTTGCT. Inner Primer PCR Length: 1177 bp. Deletion Size: 534 bp. Deletion left flank: CTCATCTCATGTCTCTTATACGGAGCATTC. Deletion right flank: ATAGAATTCCAAGCATTGGATAATGATTAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK632.3. Homozygous. Outer Left Sequence: CGCTCATCGTCAGTGAAAAA. Outer Right Sequence: GTCAGTTTTGCGGATGTCCT. Inner Left Sequence: CCCATTCCACGTTTTTGAGT. Inner Right Sequence: ACTTGCTCTTCAACGCCATT. Inner Primer PCR Length: 1108 bp. Deletion Size: 371 bp. Deletion left flank: GCCGACCATATCGCCTGTTGGAAGGGTGTT. Deletion right flank: AAGACGAGAATTCGTTGCATTTTCCTCATC. Insertion Sequence: TCCCTTCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04A11.4. Homozygous. Outer Left Sequence: GGGAGATCAAATTTCGGTGA. Outer Right Sequence: CGATTGGCGGAAATTCTAAA. Inner Left Sequence: TCCAGATTCAAAAGAGACGTTG. Inner Right Sequence: CCACTGAGCGTAGTCCACCT. Inner Primer PCR Length: 1253 bp. Deletion Size: 989 bp. Deletion left flank: CTTGATGACGTGGGTGTTCCTATACAAAAA. Deletion right flank: TTTGTATAAAAATAGAGAAAAATATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G8AL.11 Homozygous. Outer Left Sequence: tttgacaccacacggaaaaa. Outer Right Sequence: tcacgttaagtattcccggc. Inner Left Sequence: aaaaacctcggccaccac. Inner Right Sequence: ttcgtgtcgagaccgaacta. Inner Primer PCR Length: 1195. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41D4B.10 Homozygous. Outer Left Sequence: gcaaattcggcaaatctctt. Outer Right Sequence: atacccctttccaaaaaccg. Inner Left Sequence: ttgccgtgcttaacaaactc. Inner Right Sequence: atgaagtcacaggtgacaaaaa. Inner Primer PCR Length: 1353. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53A3.6 Homozygous. Outer Left Sequence: agtacccaaaaaccaagggg. Outer Right Sequence: cgtacctcgggaaattcaaa. Inner Left Sequence: gtgacggggaatttgaaaaa. Inner Right Sequence: taggggtaaaattacgcggg. Inner Primer PCR Length: 1288. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04D8.2 Homozygous. Outer Left Sequence: cggccggaatctaatttttc. Outer Right Sequence: aaacgacttccaattttgcg. Inner Left Sequence: cacaatcgtcagtagggaaaaa. Inner Right Sequence: cgacacggtcagtgagaaag. Inner Primer PCR Length: 1274. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08E3.4 Homozygous. Outer Left Sequence: caacttgagacatggtgcgt. Outer Right Sequence: atgtctgttgctctttgcca. Inner Left Sequence: gccaagaccacattgagaca. Inner Right Sequence: tctctacgaagttctcgacaaaaa. Inner Primer PCR Length: 1155. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04A9.4. Homozygous. Outer Left Sequence: AAACATTCGTTCATTTCCGC. Outer Right Sequence: GCACAGCAGCGATGTAAAAA. Inner Left Sequence: ATTTAAGTGGCTGGTGTGGC. Inner Right Sequence: CGTTTTGCCAATCGAATTTT. Inner primer WT PCR product: 2315. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y74C9A.4. Homozygous. Outer Left Sequence: CATCGATTGGATCAGCTTCA. Outer Right Sequence: GCGCCCAAAAATTACAAAAA. Inner Left Sequence: GCCTGATGGTTTACGGAGAA. Inner Right Sequence: TTGATTTTCAGACGTGCAGC. Inner Primer WT PCR Product: 3251. Deletion size: 696 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK822.3. Homozygous. Outer Left Sequence: CTGAATCGCCGTAATCCAGT. Outer Right Sequence: TTTGCTGTAGGCCTGCGTAT. Inner Left Sequence: AAACTCAACGCCTCGAAAAA. Inner Right Sequence: AATGCAGGTGTAGGTAGGCG. Inner Primer WT PCR product: 3318. Deletion size: 2277 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12H4.1. Homozygous. Outer Left Sequence: TGACGAAATCAAAATGCCAA. Outer Right Sequence: AATGAGGAAGACGAGCTCCA. Inner Left Sequence: ATCCCGACAAAATCGAAAAA. Inner Right Sequence: GTCGGGAATCTGATCTTCCA. Inner Primer WT PCR Product: 2816. Deletion size: 1315 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve616 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaacaacagcTTAAGCGATGGATCCAGCG ; Right flanking sequence: CGTCCTCTCTTCGACATtttacctgaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttttgtctccgttttttgcgttgttttcct ; Right flanking sequence: tccattctagtccatgaaaaatttcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes Dpy and unhealthy. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Dpy adults (ve662 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: agaagaaacaaagaaatcccaaaaaaaaaa ; Right flanking sequence: Tatccgattattacagtattaaattctatc. sgRNA #1: aagaaaaaagaaacggtata; sgRNA #2: actgtaataatcggatATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve670 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aagatccagcttaggttcagttaacgcggc ; Right flanking sequence: tatggaatttttcagatttttctccaaaaa. sgRNA #4: GGATACTTCCATGTATCCCA; sgRNA #5: AACGTCGAATAATAGCGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 1689 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve763 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: gaaatcagtgatcaggcaacagacaacagc ; Right flanking sequence: cggaaatcgcgatggcgaagcacacaaaaa. sgRNA #1: tgatgtgaaccagagaaagc; sgRNA #2: ggtaaaagtctgcggaatga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 531 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGGCAAAGCCACTGAAGGCCGCAAAAAA ; Right flanking sequence: cggtcaaatattatgccatctcatccgcaa. sgRNA #1: AACGGAGAAGGATCTTTCTG; sgRNA #2: CAGGAAAGAAGTAAttgcct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1174 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCATCATTATTTTTTCTTTCACaaaaaaa ; Right flanking sequence: TTTGTAAGAGGGCATATTTTATTTGTGAAG. gst-22 sgRNA A: aCAATTCACACAAGCGTCAC; gst-22 sgRNA B: CTGACTTACTTTGATGCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACACCTTATTATTAAAATAGTATTGCCCT ; Right flanking sequence: GATATCACGTCGTCATTGATTTTATTGACA. Y43E12A.2 crRNA A: GGAGAAAAGCAAGGGAAAAA; Y43E12A.2 crRNA B: TCTTCGTGTTTCCGTGCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa

F30A10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1602 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTAATGGCTCCTTGCTCAGG. External right primer: CCGAACCGCAAGTTGTTTAT. Internal left primer: GTCACAGCTAATGGGAGCGT. Internal right primer: AACTCAACAGGATCCCTCCA. Internal WT amplicon: 3044 bp. Deletion size: 745 bp. Deletion left flank: CTTGTAAATCAAAAAGGAAGAGAGAAAAAA. Deletion right flank: CTACGGAAAACACTTTTTTACTACCTTATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06H7.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1657 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACGCAAAATACGCAAAAA. External right primer: GGAAGTGCTGATTTGGCAGT. Internal left primer: ATGACGACAGTTCTGCAACG. Internal right primer: GGCTGACGATCTCTTGGAAA. Internal WT amplicon: 3306 bp. Deletion size: 650 bp. Deletion left flank: CCTAAATTATATATAACATTTTCAGAAAAA. Deletion right flank: GACCTGACACTGTACAACAAATTATCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H20J04.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1739 homozygotes (slow-growing, sickly, mostly sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CCCGGAGCATGAAATTCTTA. External right primer: AATGGAGCTCGAAAATGTGG. Internal left primer: TCCAACGCACAATTGAAAAA. Internal right primer: TCCAGCAAAATATGGTGCAA. Internal WT amplicon: 2146 bp. Deletion size: 853 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39A1A.5. Superficially wild type. External left primer: TGTGATGGACCAAGTGGAAA. External right primer: AACGGTGGGGGAGATAAAAA. Internal left primer: TTTTGAGGCGCTTAAGGAGA. Internal right primer: TTGAGAAAAAGCCTTTCGGA. Internal WT amplicon: 3134 bp. Deletion size: 1739 bp. Deletion left flank: GGAAAAATTGGAAATTAAATTGGAAAAAAA. Deletion right flank: TATCACTGTCCCGTCAATCATCTGAATCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07H8.3, K07H8.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1907 homozygotes (Unc, late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGAACTTATTGCCACCACGG. External right primer: ATCCTCCTGAAAGGGGAGAA. Internal left primer: CAGAGAAATCTCCTCGACCG. Internal right primer: CCAGTTGGAAAAGGCAAAAA. Internal WT amplicon: 2234 bp. Deletion size: 1757 bp. Deletion left flank: CCGCCACCACGTGGGGTGAAGCCACTGCCA. Deletion right flank: GAAGAACGGAACATCGAGCCAGCAGATCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK792.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1932 homozygotes (late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAATACGAGGGAGCAAAAA. External right primer: ACTCATTCCGACTCACCACC. Internal left primer: AAATGAGTTGGCGAAATTGG. Internal right primer: CCCACAGAAATCCTTCTCCA. Internal WT amplicon: 2164 bp. Deletion size: 992 bp. Deletion left flank: CCTTAATTGTACATTAAAAACATTATTTTT. Deletion right flank: TTCGTCTTTGGAATCAATTAAACAGCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32C4.5. Superficially wild type. External left primer: GAACATTTGGTTGCAGCAGA. External right primer: AAGCACGGAGACGAGAAAAA. Internal left primer: CGCCTGACATCCGATCTATT. Internal right primer: TGCCATTGATGTTGCAGTTT. Internal WT amplicon: 2340 bp. Deletion size: 586 bp. Deletion left flank: AAGAAGGGACACAAACAGAAATGTCCATAC. Deletion right flank: TCGGCATCTTTTTTCATACATGAACAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C2.4, C16C2.3. External left primer: TGTTAGCTGCTGAATCACGG. External right primer: TGCACTTGAATCTGGACAGC. Internal left primer: GAAGTCCTTGCCACGGTAAA. Internal right primer: CCTACAATTCCGAGTGCCAT. Internal WT amplicon: 1898 bp. Deletion size: 1465 bp. Deletion left flank: TCTTTCCAGCGTCCTTCGCATATTCAAAAA. Deletion right flank: AAATAAAGAAAATATTAAACAAAATCGTTG. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D1.4. External left primer: CAGATGGTGGAGGAACTGGT. External right primer: GGTTTTGACACCTCTCCGAA. Internal left primer: CGAATTCGAGATGCCAGATT. Internal right primer: TCACGCATTGTTCGAAAGTT. Internal WT amplicon: 1953 bp. Deletion size: 1329 bp. Deletion left flank: ATATTGAAGTCTTGTTTCTACTGTGTTTGA. Deletion right flank: ACAAAAGCAAAAATTACCCTTGAAGAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57A10.6. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1323 bp. Deletion left flank: TTCTGATATCCCAGGAAGGCCTGAAAAATT. Deletion right flank: GTTAATTTTTTTAAAATCCCAGCTCAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48A7.2. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2116 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTACGCCGGAAAGACAAAAA. External right primer: AAATCAATGAATGTGGGGGA. Internal left primer: TAAATGACGCCGAATTGTCA. Internal right primer: ATCGAAACTGCGCTGATCTT. Internal WT amplicon: 3253 bp. Deletion size: 1307 bp. Deletion left flank: TTGTTACAATAACTATGCAAATGTAAATAT. Deletion right flank: CCCCAAGATATAGTTTCGATAAGTAAATAC. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58H1.4. External left primer: TCGCCATAATCATGCAAAAA. External right primer: TTGCACTATTCCAGTGCTCG. Internal left primer: GATGCCCGTATCAACGAGAT. Internal right primer: ATGTGCCAAAGCATAACACG. Internal WT amplicon: 2318 bp. Deletion size: 979 bp. Deletion left flank: AAATTTAAAGGACACTGATCGAAGTTTAGT. Deletion right flank: CAACTTTCCCTCATGGTACTTGTTCGCTAT. Insertion Sequence: TTCCCTCAGGGTACTTGTT. gpla-1 formerly known as flr-2. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21C3.6. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: AACAATCAACGGATGAAGGC. Internal left primer: TGATGGCTGACTTTGAGCAT. Internal right primer: GCGTCACTGATTGGTCTGAA. Internal WT amplicon: 1902 bp. Deletion size: 853 bp. Deletion left flank: AGTGAAAGAAAACAAAATTGTGTTTAAAAA. Deletion right flank: AGTGAAAACTACAAGACCAATAAGGGATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C35E7.6. External left primer: AAAACGGAAACGCAGAAAAA. External right primer: CGATTTATCCGTTAGCCGAA. Internal left primer: ACAGCCCGTCTGAAAGCAT. Internal right primer: CCCTGAATGGAACCTTTTGA. Internal WT amplicon: 3224 bp. Deletion size: 1875 bp. Deletion left flank: TTGGTTCGATTTGAGTGATTTTCTTTAAAA. Deletion right flank: TAAGCTCAAGCTCATAAGTTACTTGTGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 472 bp. Deletion left flank: AGTCATTGCACAGCTGGAACAGCAACAGAGACTAGAAAAT. Deletion right flank: ATGATTTTTTCTTGGCTTAAACGATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y49E10. External left primer: ACCGCACCACATATGATTGA. External right primer: GTCGTCGTCGGAACACATAA. Internal left primer: AATGCGCGCGCTTAGTAG. Internal right primer: TCACCTGTTTTAGGCATTTTCA. Internal WT amplicon: 3186 bp. Deletion size: 1053 bp. Deletion left flank: TCGAGAGTACAAAATAAGCCTGTGGAAAAA. Deletion right flank: TCCAGATCTAAATAAAGGTTTATAACAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69A2AR.29. External left primer: ATTTCCGACGACGAACTGTC. External right primer: ATCTCCAGACTGGTGTTCCG. Internal left primer: CAAAGTTGGTGGCCTAGGAA. Internal right primer: ATTCTACCCGCATCATTTGC. Internal WT amplicon: 2637 bp. Deletion size: 2266 bp. Deletion left flank: TGACGACTTCTATTTGATGGCCTAACTTCC. Deletion right flank: AATTGTAAGGCTAATGAAGCAATGAAAAAA. Insertion Sequence: AGAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1068) in Y53F4B.4 and Y53F4B.42, detectable by PCR using the following primers. External left primer: GGCAAAATTGTACGCATCCT. External right primer: CTTGTTTCGCTCGATTCACA. Internal left primer: TCTCGTTAGGTATTTGCGGC. Internal right primer: CGCAACTGCGTTAAATCGTA. Internal WT amplicon: 2605 bp. Deletion size: 557 bp. Deletion left flank: AATAGAAAATGCATTTTAAAATGCGAAAAA. Deletion right flank: CCCGATTTTTGACCGATGACACCAAAGTTT. Validation: gk1068 passed by CGH. Other deletions (gk3262, gk3263) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B12.5. External left primer: AATTGTACGGCGGAAAACTG. External right primer: ACCACGGTTGCATAGGACTC. Internal left primer: CTTGGCAAGACAAATGATCG. Internal right primer: CTGGACGGGTCAGTTTCAAT. Internal WT amplicon: 2766 bp. Deletion size: 1271 bp. Deletion left flank: GCATTTGGTCTCAATGAAAAAAAGAATCAG. Deletion right flank: TTAATTAGTACCACATTTAGGATGCAAAAA. Insertion Sequence: AAAAAGAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0303.8, B0303.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2494 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGCCCTGGAAGACATTGAT. External right primer: AGTGAAACCATTGTCGGAGC. Internal left primer: ACCACCATACGGATCTCCAA. Internal right primer: CGGACTTTTTGGTTTCGATT. Internal WT amplicon: 2348 bp. Deletion size: 1060 bp. Deletion left flank: GAGTTTGGTATCCAGGTGTTGAAGTTTGAA. Deletion right flank: ACTGGGAAGGGACTGTTAGTTTTCTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807