Strain Information
| Name | TOG3 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | Y74C10AL.2(ogr3) I. |
| Description | Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa |
| Mutagen | trimethylpsoralen and UV |
| Outcrossed | x7 |
| Made by | Tarou Ogurusu |
| Laboratory | TOG |
| Reference | no |
Sign in
or
register an account if you want to order this strain.