T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

otEx6740 [str-148p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.