Search Strains

wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpIs39 [unc-47p:mCherry] X. wpIs9 [unc-47p::DLK-1::mini-GFP + ccGFP]. mCherry expression in GABA neurons and GFP expression in coelomocytes. Over-expression of dlk-1. Reference: Byrne AB, et al. Elife. 2016 Oct 4;5. pii: e12734.

oxIs12 [unc-47p::GFP + lin-15(+)] X. Reference: Byrne AB, et al. Neuron. 2014; 81(3):561-73.

wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. wpEx180 [sur-5p::sur-5::GFP::NLS]. Derived by micro-injection of of XE1375 with sur-5p::GFP transgene. Pick GFP+ to maintain. Reference: Firnhaber C, & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

ccIs4595 [ceh-24::GFP + rol-6(su1006)]. wpEx482 [ceh-17::NLS::TagRFP + pha-1(+)]. Maintain at 25C to retain array. GFP expression in vulval muscles, m8, and set of neurons in the head. The four SIA neurons are marked with both GFP and RFP. Can be used to isolate SIA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

wp127 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous ric-7 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: Wu Y, et al. bioRxiv [Preprint]. 2023 Jul 12:2023.07.12.548706. doi: 10.1101/2023.07.12.548706. Update in: J Cell Biol. 2024 May 6;223(5): PMID: 37502914.

oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.

LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP was inserted at the 3' end of the endogenous nhr-67 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.

H1::mCherry was inserted at the 3' end of the endogenous nhr-34 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.

SL2::H1::mCherry was inserted at the 3' end of the endogenous tlp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.

vab-1 null and itr-1 gain of function. Viable. Unc.

Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.

Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.

yakEx126 [unc-17p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from cholinergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx126 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx131 [eft-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a ubiquitous promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx131 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx137 [unc-14p::hif-1(P621A)::YFP + myo-2p::mCherry]. Pick animals with red pharynx to maintain. Non-degradable form of HIF-1 tagged with YFP expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx137 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx136 [vha-6p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from intestine-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx136 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx142 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. unc-14 promoter drives GFP expression in several tissues including neurons, intestine, muscle, hypodermis. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx143 [dpy-7p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a hypodermal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx143 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx144 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx144 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx145 [unc-47p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from GABA-ergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx145 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx125 [rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx125 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx146 [vha-6p::hif-1(cDNA) + dpy-7p::hif-1(cDNA) + rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-, hypodermal-, and intestinal-specific promoters in hif-1 mutant background for tissue-specific rescuing experiments. yakEx146 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

X-autosome chromosome fusion. IVR and XR telomeres are fused. Generated in a trt-1(ok410) mutant N2 background. Although outcrossed, ok410 might still be present in the background. Reference: Lowden M, et al. Genetics. 2008 Oct;180(2):741-54. doi: 10.1534/genetics.108.089920. PMID: 18780750.

Extended life span. daf-d.

Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok597 homozygotes (Emo, Ste). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, Kawasaki I, Shim Y. (2010) J Cell Sci 123:993-1000.

vr25 is a Crispr/Cas9-induced 56 bp deletion in exon 2 of oef-1/F49E8.2 causing a frameshift and presumptive null allele. Accelerated rate of germ cell progression, precocious Z2/Z3 division in L1s, increased brood size and sperm generation, and increased germline apoptosis. Reference: McManus, CE & Reinke, V. Genetics. 2017; https://doi.org/10.1534/genetics.117.1123.

gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249. Seems to grow better at lower temperatures.

3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Mano & Driscoll (2009) J Neurochem 108(6):1373-84.

Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.

Reference: Iwasa H, et al. Aging Cell. 2010 Aug;9(4):490-505.

agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. atf-7(qd22 qd130) suppresses increased pathogen susceptibiliy (Esp) of pmk-1(km25). References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892.

agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. Intestinal GFP expression from agIs219 is abolished by km25. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.

iaIs7 [nhr-57p::GFP + unc-119(+)] IV. Over-expression of nhr-57:GFP in vhl-1 mutant background. Reference: Shen C, et al. Genetics. 2006 Nov;174(3):1205-14.

iaIs7 [nhr-57p::GFP + unc-119(+)] IV. GFP expression is very weak. Reference: Shen C, et al. Genetics. 2006 Nov;174(3):1205-14.

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. nhr-57p::GFP is expressed at low levels. Superficially wild-type. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. ia61 was induced by Mos1 mutagenesis. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).