| VC958 |
C. elegans |
tag-329(ok1458) V/nT1 [qIs51] (IV;V). Show Description
C50F4.3. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1458 homozygotes (slow-growing with small broods, some larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC959 |
C. elegans |
folt-1(ok1460) V/nT1 [qIs51] (IV;V). Show Description
C06H2.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1460 homozygotes (large, healthy sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC960 |
C. elegans |
tag-335(ok1456) IV/nT1 [qIs51] (IV;V). Show Description
C42C1.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1456 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC964 |
C. elegans |
tag-321&tag-322(ok1422) IV/nT1 [qIs51] (IV;V). Show Description
C33H5.10, C33H5.19. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1422 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC966 |
C. elegans |
pin-2(gk423) IV. Show Description
F07C6.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC968 |
C. elegans |
spp-10(gk396) IV. Show Description
C28C12.7a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC976 |
C. elegans |
exc-9(gk395) IV. Show Description
F20D12.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC994 |
C. elegans |
inx-9(ok1502) IV. Show Description
ZK792.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VH1312 |
C. elegans |
nas-6(hd108) IV. Show Description
Slow growth. Reduced rate of pumping and abnormal morphology of the grinder in pharynx. Reference: Park JO, et al. BMC Dev Biol. 2010 Jan 28;10:14.
|
|
| VH4 |
C. elegans |
rhIs4 III; zag-1(rh315) IV. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Hypomorph. Unc. Axon outgrowth defects and misexpression of glr-1::GFP marker.
|
|
| VH7000 |
C. elegans |
F21D5.6(hd7000[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Deletion of 964 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAAGCAGATTTTTTTCCAAAAAATGAGCT; Right flanking sequence: CGGATTCTGGTAATTTTGCAGGTTTAGTTT. sgRNA #1: GATTGATTTGGTTCCCTTCG; sgRNA #2: TTTTCTCGAATAACTCTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7022 |
C. elegans |
ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7032 |
C. elegans |
npp-1(hd7032[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 3583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGGAGGGTGCCAGCAAACGCGCCCCT; Right flanking sequence: TGGCAGAAAATTGTTTTTAAAACTTATACA. sgRNA #1: CGAATTTTGTCTGTGTACGA; sgRNA #2: CTGTTTCGACCTAAGATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7039 |
C. elegans |
trcs-1(hd7039[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2438 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTATAAATCAAATTAACGGAGATCGTA; Right flanking sequence: GGGAGATCAAAACGTGTTTAGAATCTTTGC. sgRNA #1: GCGAGACCCAATGCGAAATT; sgRNA #2: TTCACATTAGGCTATTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7043 |
C. elegans |
mpz-5(hd7014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATAAGAAAGTTTTTTTTTTAATTTTTAA; Right flanking sequence: ATGCCCGTTGCCATGCCGTTGTTCCGATAG. sgRNA #1: AAAGCTGTCTCACAAAGTAA; sgRNA #2: GAGGAGGAAAGGAATTAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7045 |
C. elegans |
cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 6270 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACGTACGTTATACGTAATAGAAGCACGTG; Right flanking sequence: CTCGGGGCGAATTCAAATAAAGATGCGGCT. sgRNA #1: CGTAATAGAAGCACGTGAGA; sgRNA #2: CGCAATTTGATCACACTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7046 |
C. elegans |
ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGAGTTAGGTTATCAATATGACGACGCCC; Right flanking sequence: TGGAAATTGAAGAAATTGCTGCTCCAGGAG. sgRNA #1: CTCATCAAACGTCTACGGCT; sgRNA #2: CGCAGTGCTCAAGGATGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7048 |
C. elegans |
gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTAAAAGTTTATCGTTTTCAATATCCA; Right flanking sequence: TGGAGCAACTGGCCAGATGCACACTTATCT. sgRNA #1: GTTGATTAATGCCGAGTTGT; sgRNA #2: GCTCAGGAGACACAGACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7054 |
C. elegans |
R09H10.3(hd7054[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 695 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTAAGAAAACTCCGCACACAAACCTCATTT; Right flanking sequence: CCCTGGAACCTACCGATTGGTCTACATCAC. sgRNA #1: GCACACAAACCTCATTTCGA; sgRNA #2: CCCGATTTCACCCTAATCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7055 |
C. elegans |
rfth-1(hd7055[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain. Homozygous early larval arrest without immediately obvious morphological defects. Deletion of 4370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCGTCAGCTGCTCCTTCGTGTCGCCCCT; Right flanking sequence: CCTAAAACATCGTTATTGATCCTCCGCAAA. sgRNA #1: ATAGTATGGAGAGAGCCCTC; sgRNA #2: ATTAGTGAATGTGAGGTGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7058 |
C. elegans |
ctf-18(hd7008[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7062 |
C. elegans |
drl-1(hd7062[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTGAATTGAAAAGGGAGTGGTTTCCCT; Right flanking sequence: CGGCATTGAGTCTGGCGGCTGTTGCCGGTG. sgRNA #1: CCGATTCCGTTCCTAATCAC; sgRNA #2: GATTGGAATGGTGTTATGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7064 |
C. elegans |
C08F8.6(hd7064[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCTCGAAAGTCAATCAATACAACTCCT; Right flanking sequence: AGGTCTCCTTTCGGGTTGGAACACTTGTAG. sgRNA #1: CCTTCTTATCGTCTTCATAC; sgRNA #2: CCTCGACTTTAAGTGCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7067 |
C. elegans |
T25B9.2(hd7067[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTCGGCAGGAGTTTGTTTTTTTTTCCT; Right flanking sequence: TGGTAAAAAATGTTCTACAATTTTTTACAT. sgRNA #1: ACATTATTCACAGTACTCAC; sgRNA #2: GTTAGAAATCATTACATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7070 |
C. elegans |
hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7071 |
C. elegans |
hda-5(hd7071[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7116 |
C. elegans |
adah-1(hd7105 [loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7135 |
C. elegans |
Y62E10A.13(hd7128[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 7162 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTACACCTTCTCTAATGACATTTCCACCG; Right flanking sequence: TATTATCAGCTGCTGATACAGATAAAAGGA. sgRNA #1: AATCCAATGAATGCATCAGC; sgRNA #2: ACTACATCACAGACTGTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7141 |
C. elegans |
F19C7.8(hd7141[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 15206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATGGTAGGTCTTTCAAGCCTGCGTGCCT; Right flanking sequence: CTTTGGGTCACCTTATGAGACATGACCGGT. sgRNA #1: TAGAAAACTAGTCATGAGGG; sgRNA #2: CGCTGAGGGATCAATGTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7156 |
C. elegans |
+/nT1 [umnls49] IV; ncx-2 (hd7147 [loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP])/nT1 V Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7147 and CGC63. hd7147 is a 7691 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCAATTCTTCAATTTTTCCAATTCTTC; Right flanking sequence: TCTTTTCTGGTCGACAAAGGTGCCTAAATC. sgRNA #1: ATAAAGTGAAGATTGGTGGG; sgRNA #2: AACAGTGTTTTGGGGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7158 |
C. elegans |
R05G6.5(hd7158[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGTTCAAAGGCAAGCACATTGGCGCGGC; Right flanking sequence: TGGAATATATTATTCAAAAACGACAATTGC. sgRNA #1: GACCGCCCGTCTCGAGACAT; sgRNA #2: TTCAGAATGAGTTCAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7165 |
C. elegans |
ps-25&sf1=all">mrps-25 (hd7151 [loxP + myo-2p::GFP::unc-54 3’ UTR + ps-2&sf1=all">rps-2 7p::neoR::unc-54 3’ UTR + loxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7168 |
C. elegans |
F56B3.6(hd7168[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7173 |
C. elegans |
+/nT1 [umnls49] IV; mrps-2 (hd7170 [loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP])/nT1 V Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7184 |
C. elegans |
C09B9.85(hd7184[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTGTGCAGATCCAACTAGGGCGTCTCCA; Right flanking sequence: AGGAAATTTTTGTCGAAAATTCTGAAAAAT. sgRNA #1: CATGGTATGGATGGAAGCAT; sgRNA #2: CAAAGTTAGCAATTTTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7186 |
C. elegans |
+/nT1 [umnls49] IV; algn-5 (hd7175[loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7175 and CGC63. hd7175 is a 1325 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCAAAAAATCAATATCTTCACCATTTTCA; Right flanking sequence: TGGAGCTACAAAATTCGCCGATTTTGAAAA. sgRNA #1: GACTTTCCTACGCAACACCA; sgRNA #2: ATTCTCTTCGCAGATGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7200 |
C. elegans |
+/nT1 [umnls49] IV; srpa-68(hd7195[LoxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7195 and CGC63. hd7195 is a 2300 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAACTCTTTTTCCACCCGGAAAGCATTCCA; Right flanking sequence: AAAATATTGAATTTAAATATTTAAATGTTA. sgRNA #1: GAAGAACAACAAGGACTTAC; sgRNA #2: CAGGGAAATGACAAACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7212 |
C. elegans |
+/nT1 [umnls49] IV; K07F5.15(hd7202[LoxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7202 and CGC63. hd7202 is a 541 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTAAAAACAATGGTTCAAGGAAAGCTCAAG; Right flanking sequence: TTGATGCTCTTTTGTTACGAACTTTATACC. sgRNA #1: CAAAAGACAGCCTTGCCAAA; sgRNA #2: AAAAGTGATTTCGTAGGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7214 |
C. elegans |
+/nT1 [umnls49] IV; ttr-33(hd7205[LoxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7205 and CGC63. hd7205 is a 672 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GACTCGAACTCAATTTGCATGTTGATAGTT; Right flanking sequence: TGGTTAGAAAAAGATACGGAGAGGAGAAGT. sgRNA #1: CCAATGTTAAAGAAAGTCTT; sgRNA #2: AAACTCTCTTATAGCACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VK3835 |
C. elegans |
atg-3(bp412) IV; vkIs3785 X. Show Description
vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. Stronger GFP expression in intestine than in wild-type background. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663.
|
|
| VKA1 |
C. elegans |
meuDf1 M. Show Description
meuDf1 is a mtDNA heteroplasmic deletion spanning 1,034 bp and encompassing nduo-4 (partial deletion), tRNA-Thr, and ctc-3 (partial deletion). Reduction in key fitness traits including (i) productivity, (ii) survivorship to adulthood, (iii) longevity, and (iv) developmental rate. mtDNA heteroplasmy: meuDf1 is present in 81.7% frequency (with ~18% WT mtDNA). Deletion breakpoints: AATTATAATCATCATCTGGG / TTAATATTAGT AGTAGACCC...CATCTGGGAGGCGTATAATT / GTAGACCCTCCGCATATTAA.
|
|
| VM396 |
C. elegans |
ocr-2(ak47) IV. Show Description
Chemosensory, mechanosensory, and osmosensory defects. Null allele.
|
|
| VQ1047 |
C. elegans |
sax-7(qv30) IV. Show Description
19,972-bp deletion of entire sax-7 locus. Location on cosmid C18F3 8,364–2,8335. Total loss of function, null mutants are viable. qv30 mutant animals display defects that are in some cases stronger than previously studied sax-7 alleles, such as nj48. Reference: Desse VE, et al. Genetics. 2021 Aug 9;218(4):iyab086. doi: 10.1093/genetics/iyab086. PMID: 34115111.
|
|
| VS21 |
C. elegans |
hjSi20 IV. Show Description
hjSi20 [myo-2p::mCherry::unc-54 3'UTR]. Targeting construct derived from pCFJ90. Single copy transgene by MosSCI, inserted into cxTi10882.
|
|
| VS27 |
C. elegans |
rde-11(hj37) IV. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.
|
|
| VS29 |
C. elegans |
hjSi56 IV. Show Description
hjSi56 [vha-6p::3xFLAG::TEV::GFP::dgat-2::let-858 3'UTR]. Targeting construct derived from pCFJ178. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.
|
|
| VT1343 |
C. elegans |
flh-1(bc374) IV. Show Description
|
|
| VT1555 |
C. elegans |
mir-59(n4604) IV. Show Description
Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT1891 |
C. elegans |
flh-3(tm3024) IV. Show Description
tm3024 deletion was generated by S. Mitani. Outcrossing was performed by M. Ow.
|
|
| VT2527 |
C. elegans |
mir-124(n4255) IV. Show Description
Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|