Strain Information
| Name | VKA1 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | meuDf1 M. |
| Description | meuDf1 is a mtDNA heteroplasmic deletion spanning 1,034 bp and encompassing nduo-4 (partial deletion), tRNA-Thr, and ctc-3 (partial deletion). Reduction in key fitness traits including (i) productivity, (ii) survivorship to adulthood, (iii) longevity, and (iv) developmental rate. mtDNA heteroplasmy: meuDf1 is present in 81.7% frequency (with ~18% WT mtDNA). Deletion breakpoints: AATTATAATCATCATCTGGG / TTAATATTAGT AGTAGACCC...CATCTGGGAGGCGTATAATT / GTAGACCCTCCGCATATTAA. |
| Mutagen | No mutagen used |
| Outcrossed | x20 |
| Made by | Katju Lab |
| Laboratory | VKA |
| Reference | In preparation |
Sign in
or
register an account if you want to order this strain.