Strain Information

Name VKA1   View On Wormbase
Species C. elegans
GenotypemeuDf1 M.
DescriptionmeuDf1 is a mtDNA heteroplasmic deletion spanning 1,034 bp and encompassing nduo-4 (partial deletion), tRNA-Thr, and ctc-3 (partial deletion). Reduction in key fitness traits including (i) productivity, (ii) survivorship to adulthood, (iii) longevity, and (iv) developmental rate. mtDNA heteroplasmy: meuDf1 is present in 81.7% frequency (with ~18% WT mtDNA). Deletion breakpoints: AATTATAATCATCATCTGGG / TTAATATTAGT AGTAGACCC...CATCTGGGAGGCGTATAATT / GTAGACCCTCCGCATATTAA.
MutagenNo mutagen used
Outcrossedx20
Made byKatju Lab
Laboratory VKA
Reference In preparation
Sign in or register an account if you want to order this strain.