Search Strains

C33H5.10, C33H5.19. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1422 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

tag-321(bon103) is a CRISPR/Cas9-engineered 1.1 kb deletion. Genotyping primers: GGTTGTTTTCCAGTCAAATCCCTCTCAC and GCACATTGAAGTTTTGAGCAAATAACAGGG; WT: ~1330 bp; bon103: ~160 bp. Reference: Vetrella M, et al. 2025 Dec 17;17(1):923. doi: 10.1038/s41467-025-67647-y. PMID: 41408045.

Derived form parental strains BAN544 and BAN545. Reference: Vetrella M, et al. 2025 Dec 17;17(1):923. doi: 10.1038/s41467-025-67647-y. PMID: 41408045.

tag-321(bon105) is a CRISPR/Cas9-engineered 1.1 kb deletion in mcu-1(ju1154) mutant background, replicating the tag-321(bon103) lesion. The resulting double mutant was crossed with C03B8.3(bon104) males to generate the triple mutant. tag-321(bon105) genotyping primers: GGTTGTTTTCCAGTCAAATCCCTCTCAC and GCACATTGAAGTTTTGAGCAAATAACAGGG; WT: ~1330 bp; bon103: ~160 bp. Reference: Vetrella M, et al. 2025 Dec 17;17(1):923. doi: 10.1038/s41467-025-67647-y. PMID: 41408045.