Search Strains

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpys, Uncs and Lets. Lethal mid-larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adults which lay eggs that do not hatch. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. DpyLets are adult steriles. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, DpyLet and dead eggs. Lethal early larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, and dead eggs. Homozygous let-276 are dead eggs. Maintain by picking semi-Dpy.

Heterozygotes are WT and segregate WT, Vul, DpyLet and dead eggs. Lethal early larval (L1) at 20C and 25C. Maintain by picking WT.

Heterozygotes are semi-Dpy and segregate semi-Dpy, early larval lethals and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Animals which carry the Dup are semi-Dpy and segregate semi-Dpy and DpyUnc (animals which have lost the Dup). Animals homozygous for the Dup are slow growing, slender and transparent. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, DpyLet and dead eggs. The DpyLets are Sterile adults. Maintain by picking semi-Dpy.

Made by outcrossing HE110 four times. su110 is moderately Smg suppressible: HE110 animals are significantly less Unc than DV2208, and HE110 animal are also pVul, which is characteristic of Smg mutations.

Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.

Homozygous viable. Weak Him phenotype (2-3%). Extremely sensitive to ionizing radiation and other DNA damaging agents.

Isolated in Arizona desert. Identification by E. Mae Noffsinger.

Isolated in Arizona desert. Identification by E. Mae Noffsinger as Acrobeloides obliquus.

Original sample from peach orchard at Lodi CA. Original culture sent to DWF from B. Jaffee. Identification by E. Mae Noffsinger.

Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.

Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. [6/98: Paul De Ley has checked this strain and suggests that it doesn't match the original description of Acrobeloides thornei very well.]

Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. Isolated in CA.

rhIs2 [pat-3::HA::GFP]. rhIs2 contains cosmid-derived full-length pat-3, including 5 kb 5’UTR and 1 kb 3’ UTR, with HA and GFP(S65C) tags inserted prior to the pat-3 stop codon. Reference: Plenefisch JD, et al. Development. 2000 127(6):1197-207. doi: 10.1242/dev.127.6.1197.

qaIs8001 [fhod-1::GFP + unc-119(+)]. Integrated functional translational FHOD-1::GFP fusion. Superficially wild-type. Reference: Mi-Mi L, et al. J Cell Biol. 2012 Jul 9;198(1):87-102. doi: 10.1083/jcb.201202053.

ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.

ezIs10 [(pWY3) lin-32::GFP + unc-119(+)].

fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.

tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

dzDf3 [I:1999831 - 2100118 deleted]. Heterozygotes are wild-type GFP+. Segregate wild-type GFP+, dead eggs, and GFP+ Lon males.

oxEx110 [unc-49c::GFP + lin-15(+)]. Maintain by picking non-Muv.

Isolated by Michael Ailion from rotting apricot from home of Wayne Davis and Danielle Endres in Salt Lake City, Utah, 8/4/2006, under tree on north side of house. Coordinates: 40° 42' 26.16" N, 111° 52' 3.27" W. Animals move very rapidly. Strain started from a single L4 hermaphrodite and grown three generations before freezing. 18S rDNA sequence differs from C. briggsae NCBI entry (PB102), but is identical to the 18S sequence of AF16, HK104, PB800 and VT847. Cross-fertile with AF16. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

oxIs253 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pCFJ68 inserted by MosSCI into ttTi5605 site.

oxIs279 [pie-1p::GFP::H2B + unc-119(+)]. Wild type. Persistent GFP expression in germline. Visible on dissection microscope. Plasmid pCFJ127 inserted by MosSCI into ttTi5605 site.

oxIs318 [spe-11p::mCherry::histone + unc-119(+)]. Wild type. Dim mCherry expression in hermaphrodite sperm. Barely visible on bright dissection microscope; visible on compound microscope. Plasmid pCFJ167 inserted by MosSCI into ttTi5605 site.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.

Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).

oxIs363 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pBN04 inserted by MosSCI into cxTi10882 site.

dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. Dpy, mCherry pharyngeal muscle, dim GFP+ in coelomycytes. Insertion/deletion into cxTi10882 MosSCI site on Chr. IV. Can be used as balancer.

Unc. MosSCI insertion strain with unc-18 marker instead of unc-119. Mos1 insertion in Chr I. Compatible with mosSCI targeting vectors pCFJ448 (Gateway) and pCFJ676 (MCS).

oxSi212 [pie-1p::GFP::mCherry::H2B::gld-2 3'UTR::operonGFP::H2B::cye-1UTR] II. Maintain under normal conditions; expression is stable. Superficially wildtype. Bright, nuclear mCherry and GFP fluorescence in germline. Reference: Frokjaer-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8.

oxSi221 [eft-3p::GFP + Cbr-unc-119(+)] II. Broad, bright GFP fluorescence clearly visible on dissection scope. Single copy insert into MosSCI site ttTi5605 on Chr. II. Can be used as balancer.

oxSi230 [eft-3p::GFP + Cbr-unc-119(+)] X. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi14024 on Chr. X. Can be used as balancer.

oxSi257 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4391 on Chr. I. Can be used as balancer.

oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4348 on Chr. I. Can be used as balancer.

oxSi346 [eft-3p::GFP + Cbr-unc-119(+)] IV. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site cxTi10816 on Chr. IV. Can be used as balancer.

oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV.

oxEx1578 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. [NOTE: New stock received at the CGC 03/21/12. Original stock was reported as no longer segregating Unc.]

oxEx1579 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.

oxEx1580 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.

oxEx1581 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.