Search Strains

tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Reference: Huelgas-Morales G., et al. G3 (Bethesda). 2016 Apr 7;6(4):1031-47.

Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C.

uwaEx1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx8 [eft-3p::CERULEAN-VENUS + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx8 [eft-3p::CERULEAN-VENUS::tomm-7 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed tomm-7 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx4 [ubc-18::GFP::HA + myo-3p::RFP + unc-119(+)]. Pick RFP+ animals to maintain. Translational GFP transgene rescues ubc-18(tm5426).

otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. otIs197 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

otEx3165 [unc-120p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from muscle-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. otEx3165 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

uwaEx2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008

WT in appearance and movement. Some slight muscle disorganization and gonad disorganization. Slightly reduced brood size. Only suppresses the unc-52(e1421) allele.

WT in appearance and movement. Some slight body wall muscle disorganization and gonad disorganization. Slightly reduced brood size. Only suppresses the unc-52(e1421) allele.

WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.

WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.

Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.

Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

The unc-112(r367); raDf4/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf4 homozygotes arrest as L2 larvae. raDf4 deletes dim-1.

The unc-112(r367); raDf6/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf6 homozygotes arrest during embryogenesis. raDf6 deletes dim-1.

raDf7 suppresses the paralyzed phenotype of unc-112(r367) because the deficiency deletes the dim-1 gene. Reduction or loss of the dim-1 gene product suppresses the unc-112(r367) phenotype. In this strain: Animals homozygous for raDf7 arrest as L1 or L2 larvae; Animals without raDf7 are paralyzed as adults; Animals heterozygous for raDf7 move reasonably well.

The unc-112(r367); raDf9/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf9 homozygotes arrest as L1 or L2 larvae. raDf9 deletes dim-1.

The unc-112(r367); raDf10/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf10 homozygotes arrest as L1 or L2 larvae. raDf10 deletes dim-1.

The unc-112(r367); raDf12/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf12 homozygotes arrest as L1 or L2 larvae. raDf12 deletes dim-1.

raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and rescues the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.

C47E8.7. Heterozygotes are WT and segregate WT, Pat unc-112 homozygotes and Unc homozygotes. Pick WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC101.2a. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and will rescue the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.

raEx110 [T05G5.1p::T09A5.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx112 [T05G5.1p::D1037.4(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx113 [T05G5.1p::W04C9.4(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx114 [T05G5.1p::R119.3(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx116 [T05G5.1p::D2024.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx117 [T05G5.1p::C17G1.7(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx118 [T05G5.1p::ZK637.3 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx136 [T05G5.1p::Y52B11A.9(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx204 [T05G5.1p::Y113G7B.17(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx272 [T05G5.1p::T11G6.8(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx307 [T05G5.1p::Y57G11C.3(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx323 [T05G5.1p::R11G1.6(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx421 [T05G5.1p::ZK1127.10(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx431 [T05G5.1p::ZK1128.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raIs8 [unc-112::GFP + rol-6(su1006)]. Rollers. raIs8 produces a fully functional GFP-tagged UNC-112 protein that localizes to the dense bodies and M-line in muscle cells. Derived by integrating raEx16 in DM7016.

edIs6 [unc-119::GFP + rol-6(su1006)] IV. Strong Roller phenotype. Hets are not Rollers (despite the presence of the supposedly dominant su1006 mutation in the array), so heterozygous males mate well. edIs6 is the integration of an array carrying pDP#MMUGF12 and pRF4. pDP#MMUGD12 ia an unc-119::GFP fusion that encodes 101 aa of UNC-119 and was made from the Fire lab vector pPD95.77. pRF4 is the rol-6(su1006) plasmid that gives a Rol phenotype. This strain allows the nervous system to be visualized by GFP fluorescence. GFP expression starts in the early embryo and continues through adulthood in most, if not all, of the nervous system. The expression of a similar lacZ fusion (but carrying a nuclear localizing signal) is described in Genetics 141: 977-988 1995.