More Fields
Strain Species Genotype
DM1151 C. elegans ccar-1(ra20) IV. Show Description
WT in appearance and movement. Some slight muscle disorganization and gonad disorganization. Slightly reduced brood size. Only suppresses the unc-52(e1421) allele.
DM1208 C. elegans unc-112(r367ra202) V. Show Description
Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.
DM1245 C. elegans unc-112(r367) V; Y102F5A.1(ra238) dim-1(ra204) X. Show Description
Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.