| NK2478 |
C. elegans |
deb-1(qy48[deb-1::mNG + LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen tag into endogenous deb-1 locus. Low penetrance Rup and Pvl. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.
|
|
| NK2540 |
C. elegans |
fdgt-1(qy65[fgt-1::mNG +loxP]) II. Show Description
Superficially wild-type. mNG tag inserted into the endogenous fgt-1 locus. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2585 |
C. elegans |
emb-9(qy83[emb-9::mRuby2 + LoxP]) III. Show Description
mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2621 |
C. elegans |
eif-1.A(qy90[eif-1.A::mNG]) IV. Show Description
mNG tag inserted into the C-terminus of the endogenous eif-1.A locus.
|
|
| NK2623 |
C. elegans |
ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type.
|
|
| NK2633 |
C. elegans |
elo-1(qy97[elo-1::mNG]) IV. Show Description
mNG tag inserted into the C-terminus of the endogenous elo-1 locus.
|
|
| NK2651 |
C. elegans |
lin-35(n745) I; emb-9(qy83[emb-9::mRuby2 + LoxP]) III. Show Description
CRISPR/Cas9 insertion of mRuby2G into the endogenous emb-9 locus (internal tag) in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2657 |
C. elegans |
nuo-1(qy143[nuo-1::mNG]) II; unc-119(ed4) III; qyIs50 V. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.
|
|
| NK2667 |
C. elegans |
F26E4.7(qy103[F26E4.7::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F26E4.7 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2668 |
C. elegans |
C16E9.1(qy104[C16E9.1::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous C16E9.1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2669 |
C. elegans |
F26E4.3(qy105[F26E4.3::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F26E4.3 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2672 |
C. elegans |
unc-40(qy68[unc-40::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous unc-40 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2673 |
C. elegans |
unc-5(qy70[unc-5::2xmNG + LoxP]) IV. Show Description
2x mNG tag inserted into the endogenous unc-5 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2688 |
C. elegans |
fbn-1(qy107[fbn-1::mNG (internal tag) + LoxP]) III. Show Description
mNG tag inserted into the endogenous fbn-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2692 |
C. elegans |
test-1(qy108[test-1::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous test-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2694 |
C. elegans |
bmdSi15 rpl-31(qy110[rpl-31::gfp11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.
|
|
| NK2698 |
C. elegans |
sax-3(qy113[sax-3::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous sax-3 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2700 |
C. elegans |
eva-1(qy114[eva-1::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous eva-1 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2701 |
C. elegans |
nas-39(qy115[nas-39::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2702 |
C. elegans |
C48E7.6(qy116[C48E7.6::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous C48E7.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2704 |
C. elegans |
cpi-2(qy117[cpi-2::mNG + LoxP]) V. Show Description
mNG tag inserted into the endogenous cpi-2 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2705 |
C. elegans |
col-99(qy118[col-99::mNG (internal tag) + LoxP]) IV. Show Description
mNG tag inserted into the endogenous col-99 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2706 |
C. elegans |
col-99(qy119[col-99::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous col-99 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2728 |
C. elegans |
cpi-1(qy127[cpi-1::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2730 |
C. elegans |
rpl-4(qy128[rpl-4::gfp11]) bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus.
|
|
| NK2738 |
C. elegans |
cox-5A(qy136[cox-5A::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-5A locus. Slightly delayed growth. Insertion verified by PCR. Left flanking sequence: 5' GGTAACATGGCCTCGTTGACC 3' ; Right flanking sequence: 5' ATATTAGGAGGTCTCAGAGGAG 3'. sgRNA: 5' AAGAAGTGGTACAAGGACTA 3'.
|
|
| NK2739 |
C. elegans |
cox-5B(qy137[cox-5B::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-5B locus. Insertion verified by PCR. Left flanking sequence: 5' TACAGCATGTGTAGACAACGAG 3' ; Right flanking sequence: 5' AAAGATGCGCACACAGACACA 3'. sgRNA: 5' TGTTTAGATGGATTCTGGGT 3'. Superficially wild-type.
|
|
| NK2743 |
C. elegans |
cox-10(qy141[cox-10::mNG]) II. Show Description
mNeonGreen tag inserted into C-terminus of endogenous mNeonGreen tag inserted into C-terminus of endogenous cox-10 locus. Insertion verified by PCR. Left flanking sequence: 5' GGCACTCACATTTTCGCGTTA 3' ; Right flanking sequence: 5' TGAAGCGCGTCTAACACGTT 3'. sgRNA: 5' GAACGGCTACAACAAAATGG 3'. Superficially wild-type.
|
|
| NK2746 |
C. elegans |
sdhb-1(qy144[sdhb-1::mNG]) II. Show Description
mNeonGreen tag inserted into C-terminus of endogenous sdhb-1 locus. Animals are slow growing with reduced brood size. Insertion verified by PCR. Left flanking sequence: 5' AACTGATGATGTAGCCGCCAAG 3' ; Right flanking sequence: 5' CAGTGAAAGTGCGTGTAGGA 3'. sgRNA: 5' ATCTCTCCGATGGCCTTAGC 3'.
|
|
| NK2751 |
C. elegans |
T19D12.6(qy149[T19D12.6::mNG + LoxP]) II. Show Description
mNG tag inserted into the endogenous T19D12.6 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2764 |
C. elegans |
adm-4(qy153[adm-4::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous adm-4 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2777 |
C. elegans |
nuo-1(qy157[nuo-1::mKate2]) II. Show Description
mKate2 tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.
|
|
| NK2789 |
C. elegans |
bmdSi15 I; shy61(sec-61.B::GFP11x2) IV. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). 2x split GFP tag (GFP11) inserted into the C-terminus of the endogenous sec-61.B locus.
|
|
| NK2794 |
C.elegans |
fdgt-1(qy65[fdgt-1::mNG + loxP]) II; unc-6(ev400) X. Show Description
mNG tag inserted into the endogenous fdgt-1 locus. Unc. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2800 |
C. elegans |
tct-1(qy161[tct-1::mNG]) I. Show Description
mNG tag inserted into the C-terminus of the endogenous tct-1 locus.
|
|
| NK2811 |
C. elegans |
F25H2.6(qy162[F25H2.6::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F25H2.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2827 |
C. elegans |
snb-1(qy164[snb-1::mNG]) V. Show Description
mNG tag inserted into the C-terminus of the endogenous snb-1 locus.
|
|
| NK2840 |
C. elegans |
mev-1(qy169[mev-1::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous mev-1 locus. Animals are slow growing with reduced brood size. Insertion verified by PCR. Left flanking sequence: 5' TATCCAGACAAACCATAGGACT 3' ; Right flanking sequence: 5' GCCGAACGAGATTAGACCTAT 3'. sgRNA: 5' CAAGAGCAACAAGACTGCCT 3'.
|
|
| NK2841 |
C. elegans |
nduf-7(qy170[nduf-7::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nduf-7 locus. Insertion verified by PCR. Left flanking sequence: 5' GCCGATTTGATTTTCGTTGCCG 3' ; Right flanking sequence: 5' GGCGAATTTGAATGGTCCAGT 3'. sgRNA: 5' GTAAGCGAGAAGCTCAACTT 3'.
|
|
| NK2844 |
C. elegans |
cox-6A(qy173[cox-6A::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-6A locus. Insertion verified by PCR. Left flanking sequence: 5' AAGGTATCCGACATGAACCGT 3' ; Right flanking sequence: 5' CCATTCAAGCTTTACAGGGTTC 3'. sgRNA: 5' TCAGCCTCGAATCCAACTCC 3'.
|
|
| NK2845 |
C. elegans |
nduv-2(qy174[nduv-2::mNG]) V. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. Insertion verified by PCR. Left flanking sequence: 5' AGATGTCGTTGGCATCGAACGT 3' ; Right flanking sequence: 5' CTTGATCGGTGGTGATAGCTGA 3'. sgRNA: 5' GCTGCTCTTAAATAAACGCT 3'.
|
|
| NK2902 |
C. elegans |
bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. Show Description
qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11
|
|
| NK2920 |
C. elegans |
emb-9(qy83[emb-9::mRuby2 + LoxP]) III; gon-1(qy45[gon-1::mNG+LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2964 |
C. elegans |
nifk-1(qy126[nifk-1::mNG]) zmp-1(cg115) III. Show Description
mNG tag inserted into the C-terminus of the endogenous nifk-1 locus.
|
|
| NK2984 |
C. elegans |
let-2(qy216[let-2::mRuby2]) X. Show Description
mRuby2 tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK2987 |
C. elegans |
let-60(qy220[mNG::let-60 + LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen tag into endogenous let-60 locus. Fairly high penetrance of L1 rod-like lethality. Reference: Jayadev et al. 2023. Post-embryonic endogenous expression and localization of LET-60/Ras in C. elegans. microPublication Biology. 10.17912/micropub.biology.000931.
|
|
| NK3018 |
C. elegans |
mtx-1(qy217[mtx-1::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous mtx-1 locus. Insertion verified by PCR. Left flanking sequence: 5' ATGGAATTACACATTTGGCCG 3' ; Right flanking sequence: 5' TGTTGAGGATCTTTCTTCCT 3'. sgRNA: 5' GACTGACACTTGAATCAGACA 3'.
|
|
| NK3026 |
C. elegans |
let-2(qy228[let-2::mNG]) X. Show Description
mNG tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3027 |
C. elegans |
qySi148 I; lam-2(qy20[lam-2::mNG]) IV. Show Description
qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. mNeonGreen tag inserted into C-terminus of endogenous lam-2 locus. Superfically wild-type strain with AC-specific plasma membrane marker and BM marker. BM visualized with endogenously tagged laminin. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3047 |
C. elegans |
immt-1(qy230[immt-1::mNG]) X Show Description
mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. Insertion verified by PCR. Left flanking sequence: 5' GTCAATCCAGAAGACGAGTT 3' ; Right flanking sequence: 5' ATCGATGAGAACGGAGGAAC 3'. sgRNA: 5' CTAATAAGTTGAGCGAATCG 3'.
|
|
