Search Strains

Vul.

Abnormal vulva (temperature sensitive). Segregates males.

WT. Muv with lin-8, lin-38 or lin-15(n767).

nIs2 [lin-11::lacZ + lin-11(+)] IV. WT phenotype. Integrated on IV near dpy-20. Derived from MT5759.

nIs2 [lin-11::lacZ + lin-11(+)] IV. Vul. Integrated on IV near dpy-20.

nIs2 [lin-11::lacZ + lin-11(+)] IV. Integrated on IV near dpy-20.

nIs2 [lin-11::lacZ + lin-11(+)] IV. Integrated on IV near dpy-20.

Unc. Muv.

WT. Synthetic Muv with lin-8, lin-38 or lin-15(n767).

Vulvaless. Slightly Unc. Throws males.

Synthetic Muv.

Heterozygotes are Muv and segregate Muv, Unc and males. Maintain by picking Muv which throw Uncs.

Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, and Sterile Muv. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.

Heterozygotes are WT and segregate WT, UncVul and lin-41 (Dpy, Scrawny and Sterile).

Temperature sensitive Muv. At 15C males will mate.

nIs51 [egl-10(+) + lin-15(+)] X. Egl-C, Bor, hyperforaging, hyperactive locomotion, and male longevity and mating reduced. By Western blotting and staining the EGL-10 protein is highly overexpressed relative to N2. nIs51 was generated by injecting the lin-15 rescuing plasmid pEK1 at 50 ug/ml and the egl-10 rescuing fragment pMK21 at 80 ug/ml into MT1642 lin-15(n765) worms. The resulting strain was gamma irradiated and an integrant isolated, and was backcrossed to N2 four times. nIs51 was mapped to the right arm of X.

nIs60 [vab-3::GFP + lin-15(+)]. Animals are non-Muv.

synMuv class B.

Dpy. n833 is a synthetic Muv with lin-15A(n767).

Mail tale abnormal. Bivulva.

nIs93 [(pJHT27)lin-36p::GFP::lin-36 (full-length coding) + rol-6(su1006)]. Rollers. Non-Muv -- nearly completely penetrant rescue of Lin-36. Reference: Thomas & Horvitz (1999) Development 126(15):3449-59.

Synthetic Muv. n433 is lin-15 Class A allele.

nIs107 [tbh-1::GFP + lin-15(+)] III. GFP expression in RIC. Reference: Alkema MJ, et al. Neuron. 2005 Apr 21;46(2):247-60.

wdEx75 [acr-5::GFP + lin-15(+)]. Expressed in B-type motor neurons.

hdIs1 [unc-53p::GFP + rol-6(su1006)] X. ufIs26 [unc-4p::mCherry + lin-15(+)]. Rollers. DA neurons marked with unc-4::mCherry and unc-53::GFP. unc-53::GFP expression in DAs is dim during L1. Can be used to isolate DA neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

ufIs26 [unc-4p::mCherry + lin-15(+)] II. vsIs13 [lin-11::pes-10::GFP + lin-15(+)] IV. GFP expression in six VC neurons and posterior intestine. VC neurons are labeled with both GFP and mCherry; co-labeling in VCs1-5 is brightest during L4 stage. Derived by crossing parental strains NC2957 and LX959. Can be used to isolate VC neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

ufIs26 [unc-4p::mCherry + lin-15(+)] II. otIs707 [bnc-1p(1.8kb)::GFP]. VB neurons are GFP+ only; VA and SABV have both mCherry and GFP. Can be used to isolate VB neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

ynIs37 [flp-13p::GFP] III. ufIs26 [unc-4p::mCherry + lin-15(+)]. I5 neurons are labeled with GFP and RFP. Can be used to isolate I5 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

wdEx353 [Y34D9B.1a::GFP + unc-119(+)]. mig-1::GFP construct made by Marc Vidal's group at Harvard as part of the promoterome project; unc-37 target gene. GFP expression observed in all classes of VNC motor neurons, head & tail neurons, body wall muscle, and intestine. [The strain is described as unc-119 and unc-119(+) as the co-injection marker, but looks to actually be lin-15 (Muv).]

kyIs5 [ceh-23p::unc-76::GFP + lin-15(+)] IV. kyIs5 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons.

zdIs5 [mec-4p::GFP + lin-15(+)] I.

cul-1 was formerly known as lin-19.

Heterozygotes are WT and segregate WT, Unc and Long Thin Steriles (that arrest before the adult stage). cul-1 animals have excess cell divisions in post-L1 blast cell lineages. cul-1 was formerly known as lin-19.

jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js410 has linked phenotype of reduced brood size. js410 is an R->Stop at aa 235. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.

jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js317 is a W->Stop at aa 861. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.

jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.May be slightly Unc. dch-1 alias sam-11.

jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)]. Expresses rab-3::GFP in most, if not all, neurons. rab-3::GFP is localized primarily to synaptic regions.

jsIs973 [mec-7p::mRFP + unc-119(+)] III. jsIs609 [mec7p::mtGFP + lin-15(+)] X. Strong RFP cytosolic marker for the mechanosensory neurons (Zheng et al. 2011, PMID 21115607). GFP mitochondrial marker expressed in mechanosensory neurons (Mondal et al. 2012, PMID 23051668).

jsIs973 [mec-7p::mRFP + unc-119(+)] III.  oxIs12 [unc-47p::GFP + lin-15(+)] X. oxIs12 integration maps at +2.0 on X. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607). Expression of GFP in all GABAergic neurons.

jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.

jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.