Search Strains

WT behavioral phenotype. Axon guidance defect in ceh-17 expressing neurons ALA and 4SIA. ceh-17 = D1007.1, a C. elegans paired homeodomain transcription factor, Phox2 orthologue. np1 is a molecular null. np1 is a 1353 bp deletion inculding 549 bp upstream of the initiator ATG and extending to the 5th codon of the homeodomain. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background, and outcrossing the strain resulted in significantly reduced quiescence during lethargus.]

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.

frEx479 [F57F4.4p::GFP + col-12p::DsRed]. Pick DsRed+ animals to maintain array. Constitutive GFP expression in posterior intestinal cells induced upon infection with Photorhabdus luminescens in posterior intestinal cells. Reference: Julien-Gau I, et al. Dev Comp Immunol. 2014 Feb;42(2):132-7.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.

frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.

AID* and EmGFP tag inserted at the 3' end of the endogenous mdt-15 gene locus by CRISPR/Cas9 engineering. This strain can be used for auxin-inducible degradation (AID) of MDT-15 protein. Reference: Lee D, et al. PLoS Biol. 2019 Aug 13;17(8):e3000415. doi: 10.1371/journal.pbio.3000415. PMID: 31408455.

Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Defective chemotaxis to NaCl. Defective osmotic avoidance. PKA ttx-4.

Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.

Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.

Nearly normal thermotaxis behavior.

Nearly normal thermotaxis behavior.

Nearly normal thermotaxis behavior.

kpIs100 [pie-1p::Ub(G76V)::GFP::H2B::drp-1 3' UTR + unc-119(+)]. [NOTE: (4/4/2025): Strain segregates Rol, and non-Rol, possibly due to a background dpy-10 mutation; both express GFP as expected. It was recommended that non-Rollers be picked when maintaining the strain.] Expresses Ubiquitin::GFP fusion protein in the germ line. The last amino acid of ubiquitin is mutated to valine (G76V), which prevents the cleavage of ubiquitin from GFP by the deubiqutinating enzymes and renders the GFP constitutively targeted for degradation by the proteasome. The strain can be used to assay proteasome activity in the germ line. Reference: Kumar GA & Subramaniam K. Development. 2018 Mar 29;145(7):dev163949. PMID: 29540500

ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https://doi.org/10.1101/2022.10.21.512874.

jlgEx220 [nep-2p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in nep-2 expressing cells, co-injected with a nuclear GFP intestinal marker. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.

jlgEx251 [myo-3p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in myo-3 expressing muscle cells, co-injected with a nuclear GFP intestinal marker, in nep-2(ok2846) mutant background. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.

Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.

Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.

Hesitation in crossing an aversive ion. Defective in behavioral plasticity after conditioned with NaCl and starvation or with temperature and starvation.

Partially resistant to 400ug/ml NaF. Suppressor of the slow-growing phenotype of mutations in flr-1, flr-3, and flr-4.

Partially resistant to 400ug/ml NaF. Weakly Dpy. (Not determined if this is due to ut5 or a closely linked mutation.) Suppressor of the slow-growing phenotype of mutations in flr-1, flr-3, and flr-4. gpla-1 formerly known as flr-2.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

Starved; feeding defective; lacks M3 neurotransmission. From DA1051. DA1051 has bor-1 in the background. bor-1 has been crossed out in JD105.

Slow pumping. vu227 is the allele that is actually present in strains DA1316 and DA1370, not ad1051. For those working with DA1316 and DA1370 it may be useful to have an avr-15(vu227) single mutant for comparison. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

Slow pumping. This strain is a replacement for the strain DA1370 whose genotype is actually avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

Slow pumping. High reversal frequency. Ivermectin resistant. This strain is a replacement for the strain DA1316 currently in the CGC stock and whose genotype is actually avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.

wrdSi18 [^SEC^mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi50 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi8 [^SEC^mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi35 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. [NOTE: The genotype of this strain was previously described as wrdSi51. The correct allele name is wrdSi35.] Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi22 [^SEC^eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). SEC spotaneously excises at a high frequency so non-rollers will appear. Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi23 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi45 [dpy-7p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi47 [dpy-7p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi44 [SCMp*::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Seam cell-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in seam cell nuclei. Some expression in hypodermal cells. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi46 [SCMp*::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Seam cell-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in seam cell nuclei. Some expression in hypodermal cells. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi58 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140

wrdSi57 [^SEC^eft-3p:TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous bli-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous nas-37 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous noah-2 locus by CRISPR. Insertion produces a translational fusion after amino acid 388. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous cpz-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-4 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.