| PJ1194 |
C. elegans |
daf-14(m77) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C.
|
|
| PJ1276 |
C. elegans |
daf-8(e1393) I; daf-14(m77) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature-sensitive. Some dauer formation at 16C.
|
|
| RB1902 |
C. elegans |
flp-19(ok2460) X. Show Description
M79.4. Homozygous. Outer Left Sequence: CGAGAACTGAAACAAACGCA. Outer Right Sequence: TGATTTGATGTGCGCAATTT. Inner Left Sequence: AACCCACACCTCAACTTTCG. Inner Right Sequence: ATTGAACCATGTCTGACCGT. Inner Primer PCR Length: 1138 bp. Deletion Size: 505 bp. Deletion left flank: TTCAAATATCATCACTTTCTTATTTTCCGG. Deletion right flank: TATTTCAGGGCAACCAATTCAGTCACAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1903 |
C. elegans |
flp-19(ok2461) X. Show Description
M79.4. Homozygous. Outer Left Sequence: CGAGAACTGAAACAAACGCA. Outer Right Sequence: TGATTTGATGTGCGCAATTT. Inner Left Sequence: AACCCACACCTCAACTTTCG. Inner Right Sequence: ATTGAACCATGTCTGACCGT. Inner Primer PCR Length: 1139 bp. Deletion Size: 268 bp. Deletion left flank: GAGTTTATTTTTTATTAACAATTATCTTTG. Deletion right flank: AACAAAAACCCAACTAATTTTGTGTGTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RM777 |
C. elegans |
cha-1(md39) IV. Show Description
Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, no long-term survival. The animals rapidly respond to temperature shift in either direction, even after more than an hour at the non-permissive temperature. Amino acid change: A499D Sequence data: AGAAAGCTGGAATTATTTAAGAAGG / C>A / TGTGCTCAAGCAGGTCAAGGTCACG (in direction of transcription). Reference: Rand JB. Genetics. 1989 May;122(1):73-80.
|
|
| SA104 |
C. elegans |
eya-1(tm759)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT. hIn1 homozygotes are Unc. tm759 homozygous arrest as early larva with incomplete penetrance (60% at 25C, 50% at 20C, 30% at 18C, and 50% at 15C). Viable tm759 homozygotes show various postembryonic phenotypes (Unc, Dpy, Egl, Mig, Muv).
|
|
| SLR158 |
C. elegans |
pmk-3(tm745) IV; dvIs67; stxEx12. Show Description
dvIs67 [tbb-6p::GFP + myo-3p::dsRed]. stxEx12 [eft-3p::pmk-3 S(EE)::SL2::mCherry]. Pick animals with mCherry expression in intestinal cells. Reference: Munkacsy E, et al. PLoS Genet. 2016 Jul 15;12(7):e1006133.
|
|
| SS712 |
C. elegans |
ife-1(bn127) III. Show Description
Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene.
|
|
| SSM72 |
C. elegans |
exo-1(tm1842) III. Show Description
Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47.
|
|
| UR109 |
C. elegans |
cwp-4(tm727) him-5(e1490) V. Show Description
Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Portman Mod & Mech (2010).
|
|
| VM763 |
C. elegans |
lin-15B&lin-15A(n765) X; akEx130. Show Description
akEx130 [(pPB45) glr-1::GFP + (pJM23) lin-15(+)]. Worms with the array are non-Muv at 20C.
|
|
| WM73 |
C. elegans |
mbk-2(ne992) IV. Show Description
Defective in mitotic spindle orientation. Mis-segregation of germline proteins PGL-1 and PIE-1. Change of cell fate (extra-gut, no gut). Defective in chromosome segregation. Temperature sensitive; maintain at 15C; 100% lethal at 25C.
|
|
| WM74 |
C. elegans |
wrm-1(ne1982) III. Show Description
Temperature sensitive embryonic lethal. Maintain at 15C. Received new stock 3/20/2008 from Mello lab.
|
|
| WM75 |
C. elegans |
wrm-1(tm514) III; neIs2 IV. Show Description
neIs2 [wrm-1::GFP + rol-6(su1006)] IV. Rollers.
|
|
| WM79 |
C. elegans |
rol-6(n1270) II; neEx1. Show Description
Rollers. n1270 is phenotypically wild type. neEx1[LIT-1::GFP + rol-6(su1006)]. LIT-1::GFP has full length LIT-1 fused to GFP in a YAC. Pick Rollers to maintain.
|
|
| WRM75 |
C. elegans |
mex-3(spr9[*tn1753]) I; ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. Show Description
Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Derived by crossing parental strains WRM52 and OD1854. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
|
|
| WRM77 |
C. elegans |
mex-3(tn1753[gfp::3xflag::mex-3]) I; ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. Show Description
Homozygous fertile. ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Derived by crossing parental strains DG4269 and OD1854. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
|
|
| WRM79 |
C. elegans |
mex-3(spr9[*tn1753]) I; sprSi1 II; unc-119(ed3) III. Show Description
Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Derived by crossing parental strains WRM52 and WRM1. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
|
|
| WUM73 |
C. elegans |
drl-1(vir11) IV; rde-1(ne219) V; jyIs8. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Sandoval LE, et al. J Virol. 2019 Jan 17;93(3):e01400-18. doi: 10.1128/JVI.01400-18. PMID: 30429346.
|
|
| WUM79 |
C. elegans |
hipr-1(vir13) III; rde-1(ne219) V; jyIs8. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Jiang H, et al. Proc Natl Acad Sci USA. 2020 Sep 8;117(36):22462-22472. doi: 10.1073/pnas.2006914117. PMID: 32839311.
|
|
| XR1 |
C. elegans |
abl-1(ok171) X. Show Description
1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.
|
|
| YA911 |
C. elegans |
ypT34 (III;X). Show Description
X-autosome chromosome fusion. IIIL and XR telomeres are fused. Generated in a trt-1(ok410); lig-4(tm750) mutant N2 background. Although outcrossed, ok410 or tm750 deletions might still be present in the background. Reference: Lowden M, et al. Genetics. 2008 Oct;180(2):741-54. doi: 10.1534/genetics.108.089920. PMID: 18780750.
|
|
| ZM7054 |
C. elegans |
hpIs321. Show Description
hpIs321 [nmr-1p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neurons ablation (AVA/AVE/AVD/others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
|
|
| ZM7055 |
C. elegans |
hpEx2999. Show Description
hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919
|
|
| ZM7212 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3088. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3088 [rgef-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
| ZM7297 |
C. elegans |
hpIs331. Show Description
hpIs331 [lgc55Bp::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation (AVB & others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
|
|
| ZM7419 |
C. elegans |
hpIs363. Show Description
hpIs363 [sra-11p::ChR2::YFP + ttx-3p::RFP]. YFP expression in AVA. RFP expression in AIY. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZM7465 |
C. elegans |
hpIs321; hpIs331; ljIs131. Show Description
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZM7646 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3197. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3197 [sto-6p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in cholinergic neurons to maintain. Body curvature becomes deeper in some transgenic animals. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
| ZM7648 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3195. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3195 [unc-25p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in GABAergic neurons to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
| ZM7656 |
C. elegans |
hpIs365. Show Description
hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZM7691 |
C. elegans |
hpIs371. Show Description
hpIs371 [unc-4p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation marker for A-class (A-MNs) and other motor neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
|
|
| ZM7696 |
C. elegans |
hpIs376. Show Description
hpIs376 [unc-25p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
|
|
| ZM7765 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3239. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3239 [lgc-55p::nca-1::GFP + nmr-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
| ZM7798 |
C. elegans |
hpIs372. Show Description
hpIs372 [acr-5p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
|
|
| ZM7963 |
C. elegans |
hpDf761 II; daf-28(tm2308) V. Show Description
Temperature-sensitive Daf-c. Maintain at 15C. hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. Development. 2014 Apr;141(8):1767-79.
|
|
| ZM7978 |
C.elegans |
hpIs327. Show Description
hpIs327 [cex-1p::tomm-20::miniSOG::sl2::Cherry]. Maintain in darkness. miniSOG and Cherry expression in RIM.
|
|