Strain Information
| Name | RM777 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | cha-1(md39) IV. |
| Description | Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, no long-term survival. The animals rapidly respond to temperature shift in either direction, even after more than an hour at the non-permissive temperature. Amino acid change: A499D Sequence data: AGAAAGCTGGAATTATTTAAGAAGG / C>A / TGTGCTCAAGCAGGTCAAGGTCACG (in direction of transcription). Reference: Rand JB. Genetics. 1989 May;122(1):73-80. |
| Mutagen | EMS |
| Outcrossed | x6 |
| Made by | Jim Rand |
| Laboratory | RM |
Sign in
or
register an account if you want to order this strain.