Search Strains

411 bp deletion removes exons 6-8. Homozygotes are viable, but are hypersensitive to DNA crosslinking.

Reference: Agostinho A, et al. PLos Genetics 2013.

Reference: Agostinho A, et al. PLos Genetics 2013.

Reference: Agostinho A, et al. PLos Genetics 2013.

Reference: Agostinho A, et al. PLos Genetics 2013.

Segregates WT GFP+ heterozygotes, non-GFP slx-1; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1 xpf-1 double homozygotes are viable. Reference: Agostinho A, et al. PLos Genetics 2013.

Him. Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. Reference: Agostinho A, et al. PLos Genetics 2013.

Hypersensitive to cep-1/p53 mediated apoptosis.

Hypersensitive to oxidative stress, heat, and UV. 606 bp deletion from nucleotide 22 of Exon 3 to nucleotide 160 of Intron 3.

GFP tag inserted into endogenous lem-3 locus by CRISPR. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.

Heterozygotes are WT and segregate WT and dead eggs. 1/3 of the WT are rad-51(lg8701) homozygotes and will give only dead eggs.

Heterozygotes are WT and segregate WT, Dpys which give only dead eggs, and dead eggs.

let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.

F52B5.5. URL: http://www.celeganskoconsortium.omrf.org.

Temperature sensitive. Dpy.

Long life. Normal fertility. Not Temperature sensitive. Stress tolerant.

zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing.

Methylviologen (paraquat) sensitive. Oxygen sensitive. Short life span.

Methylviologen (paraquat)-resistant. Oxygen sensitive.

Methyviologen (paraquat) hypersensitive.

cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.

cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.

Hypersensitive to Paraquat. Growth arrest under hyperoxia (90% oxygen) at any larval stage. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.

Recessive Dpy. Rounded head. Reduced brood size

Morphological changes in the rays, especially transformation of ray 6 into a thickened shape. Appearance of abnormal protuberances around rays. Closed structure of the fan. Impaired mating ability. Exons 8-10 of the adt-1 gene, encoding most of the metalloproteinase domain of ADT-1, are deleted in adt-1(cn30).

The hab-1(cn308) mutant is slowly habituated and rapidly recovered from habituation when given repetitive mechanical stimuli.

Recessive Dpy. Rounded head.

Recessive Dpy. Rounded head. Reduced brood size.

Slow growth, Slow movement. ogr1 is a 1.2 kb deletion causing a frameshift at residue 54 and premature stop at residue 83. Reference: Ogurusu T, et al. Biochem Biophys Res Commun. 2015 Aug 7;463(4):994-8. PMID: 26079877

Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt

Heterozygotes are WT and segregate WT , Longs, and strong Dpys which are Sterile. Maintain at 15 degrees.

WT. Deletion mutant in T20B3.7. Deletion is 1241 bp (T20B3 25891-27132). phy-3.

Maintain at 15 degrees. Heterozygotes are WT and segregate WT , Longs, and strong Dpys which are Sterile.

Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.

xuEx705 [npr-9p::GCaMP3.0 + npr-9::DsRed2B]. Superficially wild-type. Maintain by picking red fluorescent animals; DsRed might not be visible at lower magnifications. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.

xuEx1040 [nmr-1p::G-CaMP3.0 + nmr-1p::DsRed]. Pick fluorescent animals to maintain. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.

Hermaphrodites have an abnormal protrusive vulva. Suppressor of certain alleles of certain genes.

Hermaphrodites have an abnormal protrusive vulva. Suppressor of certain alleles of certain genes.

Abnormal migration of AVM and PVM cells.

Touch insensitive in tail.

Him. Enhanced RNAi background. Maintain under normal conditions.

Touch insensitive-at the tail. Degeneration of a small set of neurons. TAB Touch ABnormal).

Strain throws WT and dead eggs.

Mutator.

Dominant suppressor of zu405. Putative oma-1 null. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].