Strain Information

Name TOG2   View On Wormbase
Species C. elegans
GenotypeT09F3.2(ogr2) II.
DescriptionSlow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt
Mutagentrimethylpsoralen and UV
Outcrossedx7
Made byTarou Ogurusu
Laboratory TOG
Reference in preparation
Sign in or register an account if you want to order this strain.