Strain Information
| Name | TOG2 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | T09F3.2(ogr2) II. |
| Description | Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt |
| Mutagen | trimethylpsoralen and UV |
| Outcrossed | x7 |
| Made by | Tarou Ogurusu |
| Laboratory | TOG |
| Reference | in preparation |
Sign in
or
register an account if you want to order this strain.