Search Strains

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5563 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4491 and CGC66. gk5563 is a 1026 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG; Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5648 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4577 and CGC66. gk5648 is a 2420 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG; Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7024 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7027 and CGC66. hd7024 is a 542 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGAGCTTTAGCTATCTTCCTTTATCCT; Right flanking sequence: ATCACAGGTGTGAAGATTTATTAAATTTTA. sgRNA #1: ATGAATGACGCAAGAATTAA; sgRNA #2: TCTGAATACTTATTGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5656 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4586 and CGC63. gk5656 is a 2105 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGCAGCTAATTTTCCATTTTTCCACTC. Right flanking sequence: TCAGCGACTCCAACGTTGATTGAGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 (gk5869 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4801 and CGC63. gk5869 is a 3129 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAATTTTCAGATGCTTCGTTCCTCAA. Right flanking sequence: CGTGGTCACCTTCTCGATCCGAAATAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (L1-L2 stage lethal), and non-GFP mKate2+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4065 and CGC53. gk5139 is a 5156 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4556 and CGC66. gk5627 is a deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

uthSi17 [myo-3p::MLS::GFP::unc-54 3’UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses myo-3 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in body-wall muscle cells. Derived by out-crossing parental strain AGD1664 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.

uthSi83 [col-19p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses col-19 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in hypodermal cells beginning in late L4 stage. Derived by out-crossing parental strain AGD2837 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.

uthSi80 [vha-6p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] IV. Single-copy insertion. MLS::GFP reporter uses vha-6 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in intestinal cells. Derived by out-crossing parental strain AGD2805 (EG6703 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.

uthSi7 [myo-3p::LifeAct::mRuby::unc-54 3'UTR, Cbr-unc-119(+)] IV. Single-copy insertion of LifeAct::mRuby labels F-actin in body wall muscle cells. Out-crossed to N2. Reference: Higuchi-Sanabria R, et al. Mol Biol Cell. 2018 Oct 15;29(21):2522-2527. doi: 10.1091/mbc.E18-06-0362. PMID: 30133343

uthSi10 [col-19p::LifeAct::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] IV. Integrated into cxTi10816. Single-copy insertion of LifeAct::mRuby labels F-actin in hypodermis beginning at late L4 stage. Out-crossed to N2. Reference: Higuchi-Sanabria R, et al. Mol Biol Cell. 2018 Oct 15;29(21):2522-2527. doi: 10.1091/mbc.E18-06-0362. PMID: 30133343

uthSi13 [gly-19p::LifeAct::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] IV. Integrated into cxTi10816. Single-copy insertion of LifeAct::mRuby labels F-actin in intestinal cells. Out-crossed to N2. Reference: Higuchi-Sanabria R, et al. Mol Biol Cell. 2018 Oct 15;29(21):2522-2527. doi: 10.1091/mbc.E18-06-0362. PMID: 30133343

unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Endogenous unc-54 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Endogenous myo-3 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. NLS-mCherry co-expressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Please contact Ryan Littlefield prior to publishing work using this strain.

Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Pharynx and body muscles are green and red fluorescent and visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work using this strain.

Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Pharynx and body muscles are green; red fluorescence only in body wall muscles. Please contact Ryan Littlefield prior to publishing work using this strain.

ihIs35 [yap-1::GFP::unc-54 3'UTR + lin-15(+)]. Translational yap-1::GFP fusion containing 5 kb of upstream regulatory sequence and 2.5kb coding genomic sequence; inserted into pPD95.75. Integration of yap-1::GFP extrachromosomal array was performed by the UV irradiation method. Reference: Iwasa H, et al. Exp Cell Res. 2013 Apr 15;319(7):931-45.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. oxIs305 [dpy-30p::mCherry::HIS-24::unc-54 3'utr + Cbr-unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

Heterozygotes are Unc and segregate Uncs, Sterile Uncs and dead eggs. Strain is sick and grows slowly. dxDf2 fails to complement unc-54, so it could delete the entire right arm of LG I.

heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi164 [rps-27::loxN::NLS::mCherry::let858 UTR::swsn-1p::swsn-1::unc-54 UTR::loxN::NLS::GFP::let-858 UTR + unc-119(+)] V. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain the line at 15C and shift to 25C for mutant analysis. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi164 carries a swsn-1 rescue construct which ensures rescue of the temperature-sensitive swsn-1(os22) mutation. Upon expression of CRE (in this case in the mesoblast lineage) the swsn-1 gene will be excised, creating a mesoblast specific mutant of swsn-1. This recombination event can be visualized by a switch from red to green in those mesoblast cells in which swsn-1 was lost. The animals are healthy at 15C, but embryonic lethal and larval arrested at 23-25C. swsn-1(os22) causes mild overproliferation in the mesoblast lineage. The swsn-1 rescuing transgene is unable to rescue germline development of swsn-1(os22) mutants. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.

mjEx331 [eft-3p::pash-1::GFP::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. Maintain at 25C. Array rescues pash-1 lethality and should be self-selecting at 25C. Pick mCherry(+) animals to confirm presence of array. SX1359 was derived from SX1137 pash-1(mj100). mj100 homozygotes can be re-isolated by raising SX1359 at permissive temperature (15C) and picking animals that have lost the array. Reference: Lehrbach NJ, et al. RNA. 2012 Dec;18(12):2220-35.

mjIs17 contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].

mjIs11 contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].

zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.

zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.

Homozygous viable. Deletion of 2032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTAGAGTTATCCACCTTTCTCGAGTTGTTC. Right flanking sequence: TTGCATCGCTTCATCAACCAAAAGGAAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3083 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGGCGACGCCGGCGGCGGTGCGCAGAAG. Right flanking sequence: ATTTTTTTTATTTATGTACCATTTGTAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. [NOTE: a user has reported that gk5787 homozygotes are viable but extremely slow growing, taking about 5 to 7 days to reach adulthood.] Deletion of 3433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGCCTATCAGTCTATAGTTTTCATTATCCA. Right flanking sequence: AATGTTTTTGTCACGAAAGTTAAATAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 5226 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACCGGTTTTCAAATGCATCTAATATACTG. Right flanking sequence: AGGATACAATTTAATTTGAAGACACAAGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3472 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGAAAAATAGCGACATATCTACAAGGCAAG. Right flanking sequence: TTAATGAGACGCCCGGCGCCAGCAGTCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6362 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TCTAGAGGTTTTCCATCTATAAGTGAGCCG. Right flanking sequence: AGGCAATCGTGAACAAGATGAATAGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3129 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CTCTCAATTTTCAGATGCTTCGTTCCTCAA. Right flanking sequence: CGTGGTCACCTTCTCGATCCGAAATAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4131 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TAGACTCGAAATTTGGCGGTTTTGGAGCCA. Right flanking sequence: GAAGCTACAGTACTCCTTGAAGGCACACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1436 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GAACCAATCAGCGACGCCTACTGCCTACCT. Right flanking sequence: TTGCTCGAGCATCGAATCGACGCGGCCATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1048 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TCGCGTCAGCGAGAAGGAAATCGAGCGCCG. Right flanking sequence: ATACGACTGAACAATTCTCTCGAAGTCTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3766 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CCCTCTTCAGAGCGTAGGTGGATATTGGTG. Right flanking sequence: AACATTTTGAAATACGTTTCAACAATAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3047 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATTCAAATATTATTTTTTTGTCCCATCCCT. Right flanking sequence: CGGTAAATTTGATTAAAATAACACTGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATTATTTTCCCGATCTCCATATAAAAACCG. Right flanking sequence: ACGAAAATTTGTTGTTTAAAAAAACTTGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2028 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TCGCAATAACCAATTTTACAAAACTAGAGG. Right flanking sequence: TGGGTTGATTTAAATTAAATATCATGTTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1683 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATGTTCGGTGATCTTTCGTATTTTTTGCCA. Right flanking sequence: AGTAGACGTACAAATGGAGCTCTAGCAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6750 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATGATGAAAAACAAGCATTCGAAAGTGCCA. Right flanking sequence: TGAACAATGTTATGAGCAGAAAAACTTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6903 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ACTTCTCTCCACCACTTTTCATTTTAACCC. Right flanking sequence: ACTGCACAGTAACACATACACATTCAACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2297 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CGATAAATAACTGAACGTCAGCTATCTCCA. Right flanking sequence: CGGTAGAAAACAAAAAAGTATTATCAGCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2468 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TACTATTAGGCTCTATTATAGGTACTATTA. Right flanking sequence: TGGGCGGGACTCTAGTGGGCGTGGTTTTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 8719 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AATAAAAATGAAAGAGACATAGGCACTTAT. Right flanking sequence: CGGTGTTCAATAAATTTGTTTGTGTTAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2578 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AAAAGTGATTTTGCGCCACTTTTTGAGCCT. Right flanking sequence: ACCAGCAACAAAGACAGTTCCAACACTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 15713 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GAAAAATTGAAAGTTCGAAAGAACAAGGAA. Right flanking sequence: TGGAGAGTGGAAACTACCATACTCCTTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1459 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TTGATTACTGTTATTTGGTAATGACTACCG. Right flanking sequence: GTGTTTTGAAACATCCAGTTGTGAGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.