| RG5054 |
C. elegans |
+/mT1 [umnIs52] II; : nlp-48(gk5563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5563 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4491 and CGC66. gk5563 is a 1026 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG; Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5056 |
C. elegans |
+/mT1 [umnIs52] II; idhg-1(gk5648[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5648 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4577 and CGC66. gk5648 is a 2420 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG; Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5059 |
C. elegans |
'+/mT1 [umnIs52] II; famh-136(hd7024[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7024 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7027 and CGC66. hd7024 is a 542 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGAGCTTTAGCTATCTTCCTTTATCCT; Right flanking sequence: ATCACAGGTGTGAAGATTTATTAAATTTTA. sgRNA #1: ATGAATGACGCAAGAATTAA; sgRNA #2: TCTGAATACTTATTGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5060 |
C. elegans |
ZK622.4(hd7010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5100 |
C. elegans |
+/nT1 [umnIs49] IV; arp-11(gk5656[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5656 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4586 and CGC63. gk5656 is a 2105 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGCAGCTAATTTTCCATTTTTCCACTC. Right flanking sequence: TCAGCGACTCCAACGTTGATTGAGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5101 |
C. elegans |
cpt-2(gk5869[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 (gk5869 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4801 and CGC63. gk5869 is a 3129 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAATTTTCAGATGCTTCGTTCCTCAA. Right flanking sequence: CGTGGTCACCTTCTCGATCCGAAATAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5103 |
C. elegans |
ampd-1(gk5139[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (L1-L2 stage lethal), and non-GFP mKate2+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4065 and CGC53. gk5139 is a 5156 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5105 |
C. elegans |
+/mT1 [umnIs52] II; mrpl-44(gk5627[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4556 and CGC66. gk5627 is a deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RHS191 |
C. elegans |
uthSi17 I. Show Description
uthSi17 [myo-3p::MLS::GFP::unc-54 3UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses myo-3 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in body-wall muscle cells. Derived by out-crossing parental strain AGD1664 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.
|
|
| RHS192 |
C. elegans |
uthSi83 I. Show Description
uthSi83 [col-19p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses col-19 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in hypodermal cells beginning in late L4 stage. Derived by out-crossing parental strain AGD2837 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.
|
|
| RHS193 |
C. elegans |
uthSi80 IV. Show Description
uthSi80 [vha-6p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] IV. Single-copy insertion. MLS::GFP reporter uses vha-6 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in intestinal cells. Derived by out-crossing parental strain AGD2805 (EG6703 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.
|
|
| RHS41 |
C. elegans |
uthSi7 IV. Show Description
uthSi7 [myo-3p::LifeAct::mRuby::unc-54 3'UTR, Cbr-unc-119(+)] IV. Single-copy insertion of LifeAct::mRuby labels F-actin in body wall muscle cells. Out-crossed to N2. Reference: Higuchi-Sanabria R, et al. Mol Biol Cell. 2018 Oct 15;29(21):2522-2527. doi: 10.1091/mbc.E18-06-0362. PMID: 30133343
|
|
| RHS42 |
C. elegans |
uthSi10 IV. Show Description
uthSi10 [col-19p::LifeAct::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] IV. Integrated into cxTi10816. Single-copy insertion of LifeAct::mRuby labels F-actin in hypodermis beginning at late L4 stage. Out-crossed to N2. Reference: Higuchi-Sanabria R, et al. Mol Biol Cell. 2018 Oct 15;29(21):2522-2527. doi: 10.1091/mbc.E18-06-0362. PMID: 30133343
|
|
| RHS43 |
C. elegans |
uthSi13 IV. Show Description
uthSi13 [gly-19p::LifeAct::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] IV. Integrated into cxTi10816. Single-copy insertion of LifeAct::mRuby labels F-actin in intestinal cells. Out-crossed to N2. Reference: Higuchi-Sanabria R, et al. Mol Biol Cell. 2018 Oct 15;29(21):2522-2527. doi: 10.1091/mbc.E18-06-0362. PMID: 30133343
|
|
| RSL47 |
C. elegans |
unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I; myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Show Description
unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Endogenous unc-54 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Endogenous myo-3 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RSL52 |
C. elegans |
unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. Show Description
Endogenous locus tagged with GFP using CRISPR/Cas9. NLS-mCherry co-expressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RSL98 |
C. elegans |
muIs252 II; unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. Show Description
Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Pharynx and body muscles are green and red fluorescent and visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RSL99 |
C. elegans |
muIs257 I; unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. Show Description
Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Pharynx and body muscles are green; red fluorescence only in body wall muscles. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
| RT3574 |
C. elegans |
lin-15B&lin-15A(n765) X; ihIs35. Show Description
ihIs35 [yap-1::GFP::unc-54 3'UTR + lin-15(+)]. Translational yap-1::GFP fusion containing 5 kb of upstream regulatory sequence and 2.5kb coding genomic sequence; inserted into pPD95.75. Integration of yap-1::GFP extrachromosomal array was performed by the UV irradiation method. Reference: Iwasa H, et al. Exp Cell Res. 2013 Apr 15;319(7):931-45.
|
|
| SD1505 |
C. elegans |
ccIs4251 I; oxIs305 II. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. oxIs305 [dpy-30p::mCherry::HIS-24::unc-54 3'utr + Cbr-unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
| SL536 |
C. elegans |
dxDf2/spe-9(eb19) unc-101(m1) I. Show Description
Heterozygotes are Unc and segregate Uncs, Sterile Uncs and dead eggs. Strain is sick and grows slowly. dxDf2 fails to complement unc-54, so it could delete the entire right arm of LG I.
|
|
| SV1578 |
C. elegans |
unc-119(ed3) III; heIs105 IV; swsn-1(os22) heSi164 V; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi164 [rps-27::loxN::NLS::mCherry::let858 UTR::swsn-1p::swsn-1::unc-54 UTR::loxN::NLS::GFP::let-858 UTR + unc-119(+)] V. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain the line at 15C and shift to 25C for mutant analysis. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi164 carries a swsn-1 rescue construct which ensures rescue of the temperature-sensitive swsn-1(os22) mutation. Upon expression of CRE (in this case in the mesoblast lineage) the swsn-1 gene will be excised, creating a mesoblast specific mutant of swsn-1. This recombination event can be visualized by a switch from red to green in those mesoblast cells in which swsn-1 was lost. The animals are healthy at 15C, but embryonic lethal and larval arrested at 23-25C. swsn-1(os22) causes mild overproliferation in the mesoblast lineage. The swsn-1 rescuing transgene is unable to rescue germline development of swsn-1(os22) mutants. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SX1359 |
C. elegans |
pash-1(mj100) I; mjEx331. Show Description
mjEx331 [eft-3p::pash-1::GFP::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. Maintain at 25C. Array rescues pash-1 lethality and should be self-selecting at 25C. Pick mCherry(+) animals to confirm presence of array. SX1359 was derived from SX1137 pash-1(mj100). mj100 homozygotes can be re-isolated by raising SX1359 at permissive temperature (15C) and picking animals that have lost the array. Reference: Lehrbach NJ, et al. RNA. 2012 Dec;18(12):2220-35.
|
|
| SX328 |
C. elegans |
mjIs17 IV. Show Description
mjIs17 contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].
|
|
| SX333 |
C. elegans |
mjIs11 III; mjIs17 IV. Show Description
mjIs11 contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].
|
|
| TJ3000 |
C. elegans |
zSi3000. Show Description
zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
|
|
| TJ3001 |
C. elegans |
zSi3001. Show Description
zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
|
|
| VC4679 |
C. elegans |
gana-1(gk5748[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTAGAGTTATCCACCTTTCTCGAGTTGTTC. Right flanking sequence: TTGCATCGCTTCATCAACCAAAAGGAAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4708 |
C. elegans |
ZK287.1(gk5777[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 3083 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGGCGACGCCGGCGGCGGTGCGCAGAAG. Right flanking sequence: ATTTTTTTTATTTATGTACCATTTGTAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4718 |
C. elegans |
cbs-1(gk5787[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. [NOTE: a user has reported that gk5787 homozygotes are viable but extremely slow growing, taking about 5 to 7 days to reach adulthood.] Deletion of 3433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGCCTATCAGTCTATAGTTTTCATTATCCA. Right flanking sequence: AATGTTTTTGTCACGAAAGTTAAATAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4722 |
C. elegans |
gar-3(gk5790[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 5226 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACCGGTTTTCAAATGCATCTAATATACTG. Right flanking sequence: AGGATACAATTTAATTTGAAGACACAAGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4741 |
C. elegans |
C56A3.6(gk5809[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 3472 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGAAAAATAGCGACATATCTACAAGGCAAG. Right flanking sequence: TTAATGAGACGCCCGGCGCCAGCAGTCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4796 |
C. elegans |
ebax-1(gk5864[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 6362 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TCTAGAGGTTTTCCATCTATAAGTGAGCCG. Right flanking sequence: AGGCAATCGTGAACAAGATGAATAGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4801 |
C. elegans |
cpt-2(gk5869[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3129 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CTCTCAATTTTCAGATGCTTCGTTCCTCAA. Right flanking sequence: CGTGGTCACCTTCTCGATCCGAAATAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4810 |
C. elegans |
Y43F4B.9(gk5878[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 4131 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TAGACTCGAAATTTGGCGGTTTTGGAGCCA. Right flanking sequence: GAAGCTACAGTACTCCTTGAAGGCACACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4831 |
C. elegans |
rpb-11(gk5899[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1436 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GAACCAATCAGCGACGCCTACTGCCTACCT. Right flanking sequence: TTGCTCGAGCATCGAATCGACGCGGCCATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4832 |
C. elegans |
Y71H2AM.4(gk5900[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1048 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TCGCGTCAGCGAGAAGGAAATCGAGCGCCG. Right flanking sequence: ATACGACTGAACAATTCTCTCGAAGTCTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4838 |
C. elegans |
Y49G6B.1(gk5906[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 3766 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CCCTCTTCAGAGCGTAGGTGGATATTGGTG. Right flanking sequence: AACATTTTGAAATACGTTTCAACAATAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4839 |
C. elegans |
F59A3.8(gk5907[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3047 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATTCAAATATTATTTTTTTGTCCCATCCCT. Right flanking sequence: CGGTAAATTTGATTAAAATAACACTGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4840 |
C. elegans |
clec-207(gk5908[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATTATTTTCCCGATCTCCATATAAAAACCG. Right flanking sequence: ACGAAAATTTGTTGTTTAAAAAAACTTGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4841 |
C. elegans |
C18A11.4(gk5909[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2028 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TCGCAATAACCAATTTTACAAAACTAGAGG. Right flanking sequence: TGGGTTGATTTAAATTAAATATCATGTTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4842 |
C. elegans |
tsfm-1(gk5910[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1683 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATGTTCGGTGATCTTTCGTATTTTTTGCCA. Right flanking sequence: AGTAGACGTACAAATGGAGCTCTAGCAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4843 |
C. elegans |
Y113G7B.15(gk5911[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 6750 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATGATGAAAAACAAGCATTCGAAAGTGCCA. Right flanking sequence: TGAACAATGTTATGAGCAGAAAAACTTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4844 |
C. elegans |
myo-2(gk5912[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 6903 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ACTTCTCTCCACCACTTTTCATTTTAACCC. Right flanking sequence: ACTGCACAGTAACACATACACATTCAACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4846 |
C. elegans |
nep-4(gk5914[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2297 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CGATAAATAACTGAACGTCAGCTATCTCCA. Right flanking sequence: CGGTAGAAAACAAAAAAGTATTATCAGCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4847 |
C. elegans |
F49C5.12(gk5915[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2468 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TACTATTAGGCTCTATTATAGGTACTATTA. Right flanking sequence: TGGGCGGGACTCTAGTGGGCGTGGTTTTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4848 |
C. elegans |
nmy-3(gk5916[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 8719 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AATAAAAATGAAAGAGACATAGGCACTTAT. Right flanking sequence: CGGTGTTCAATAAATTTGTTTGTGTTAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4849 |
C. elegans |
ppfr-4(gk5917[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2578 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AAAAGTGATTTTGCGCCACTTTTTGAGCCT. Right flanking sequence: ACCAGCAACAAAGACAGTTCCAACACTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4850 |
C. elegans |
B0207.5(gk5918[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 15713 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GAAAAATTGAAAGTTCGAAAGAACAAGGAA. Right flanking sequence: TGGAGAGTGGAAACTACCATACTCCTTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4851 |
C. elegans |
K11E4.2(gk5919[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1459 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TTGATTACTGTTATTTGGTAATGACTACCG. Right flanking sequence: GTGTTTTGAAACATCCAGTTGTGAGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|