| MT1072 |
C. elegans |
egl-4(n477) IV. Show Description
Egl. Odr-see 1998 ECWM #71.
|
|
| MT1073 |
C. elegans |
egl-4(n478) IV. Show Description
Egg laying defective. Retains late stage eggs. Odr-see 1998 ECWM #71.
|
|
| MT1074 |
C. elegans |
egl-4(n479) IV. Show Description
Temperature sensitive Egl. Odr-see 1998 ECWM #71.
|
|
| MT1085 |
C. elegans |
unc-8(n491) IV. Show Description
Coiler Unc. Dominant.
|
|
| MT1086 |
C. elegans |
unc-8(n492) IV. Show Description
Semi-dominant curly Unc.
|
|
| MT10869 |
C. elegans |
ced-10(n3417)/lin-1(e1275) dpy-13(e184) IV. Show Description
Heterozygotes are semi-Dpy. Throws DpyLins and DTC-defective progeny.
|
|
| MT1092 |
C. elegans |
unc-43(n498) IV. Show Description
Gain of function allele. Small, almost paralyized. Egl. Semi-dominant. daf-C at 27C.
|
|
| MT11713 |
C. elegans |
mep-1(n3702) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, PvlSte, and dead eggs.
|
|
| MT11836 |
C. elegans |
ark-1(n3701) IV. Show Description
SynMuv.
|
|
| MT12024 |
C. elegans |
unc-24(e138) dpy-20(e1282) IV. Show Description
Dpy (ts). Unc (amber).
|
|
| MT1206 |
C. elegans |
egl-21(n576) IV. Show Description
Egl. Reference: Genetics (1983) 104:619-47.
|
|
| MT1207 |
C. elegans |
unc-31(n577) IV. Show Description
Temperature sensitive. pka egl-22.
|
|
| MT1208 |
C. elegans |
egl-38(n578) mec-3(n3197) IV. Show Description
Egl. Strain contains both a mec mutation and an egl mutation. Touch insensitive. Abnormal vulva. Forms bags of worms.
|
|
| MT1212 |
C. elegans |
egl-19(n582) IV. Show Description
Egg laying defective. Retains late stage eggs. Slow and Floppy; Long.
|
|
| MT1215 |
C. elegans |
egl-20(n585) IV. Show Description
Egg laying defective. Retains late stage eggs. partially ts
|
|
| MT1231 |
C. elegans |
egl-23(n601) IV. Show Description
Egg laying defective. Makes bags of worms. Dominant. Sluggish.
|
|
| MT1236 |
C. elegans |
egl-40(n606) IV. Show Description
Egg laying defective. Retains late stage eggs. Semidominant. Temperature sensitive-non or weakly Egl at 15C. Males mate.
|
|
| MT1241 |
C. elegans |
egl-21(n611) IV. Show Description
Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C.
|
|
| MT1242 |
C. elegans |
egl-4(n612) IV. Show Description
Temperature sensitive Egl. Odr-see 1998 ECWM #71.
|
|
| MT12755 |
C. elegans |
ceh-32(ok343) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. ok343 is lethal or has a linked lethal.
|
|
| MT12945 |
C. elegans |
mir-52(n4100) IV. Show Description
Deletion breakpoints are: CTACTCCTACAACTACAACTAC / TACTACTACTATA...ATCACGTTTAAATCA / ATTTCCCAAGAGTTTTCGTATAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12989 |
C. elegans |
mir-53(n4113) IV. Show Description
Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12990 |
C. elegans |
mir-52(n4114) IV. Show Description
Deletion breakpoints are: CTTACCCCCCAAACCCTG / CCGCTACTACTACTACTCCTA...GAAAGGGTAGCCGGTTATT / GAAGTTGGGTCTTTTTTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13172 |
C. elegans |
mys-1(n4075) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. The myo-1(n4075) deletion removes 1010 nucleotides from the mys-1 locus (VC5.4). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 106 and ends at about nt. 1115 to give the junction sequence GATGCCGGT/TCTGCGTGGG.
|
|
| MT13292 |
C. elegans |
mir-124(n4255) IV. Show Description
Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1337 |
C. elegans |
lin-12(n137) III; nT1 (IV;V). Show Description
|
|
| MT1338 |
C. elegans |
lin-31(n301) II; nT1 (IV;V). Show Description
|
|
| MT1341 |
C. elegans |
lin-12(n302) III; nT1 (IV;V). Show Description
Vulvaless.
|
|
| MT1348 |
C. elegans |
dpy-20(e1362) lin-3(e1417) IV. Show Description
Dpy. Vul.
|
|
| MT1438 |
C. elegans |
daf-1(n690) IV. Show Description
Egl. Temperature sensitive Daf-C.
|
|
| MT14446 |
C. elegans |
mir-228(n4382) IV. Show Description
Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14449 |
C. elegans |
mir-232(nDf56) IV. Show Description
Deletion breakpoints are: GATGTATTGGGAGTCTTTTTAGGT / TATGGACCAGG...TTTCGTGCGT / CACTTTTTTTATAAGCTCTACCGTATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14450 |
C. elegans |
mir-51(n4473) IV. Show Description
Deletion breakpoints are: TTTGAATGAATATCTGGTTACCAAAA / CAATTACCA...CCAAAACATACGGT / TGTGAAAGGAAAGAAAAGCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14531 |
C. elegans |
prg-2(nDf57) IV. Show Description
Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone).
|
|
| MT14661 |
C. elegans |
mir-265(n4534) IV. Show Description
Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14725 |
C. elegans |
sfa-1(n4562) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.
|
|
| MT14878 |
C. elegans |
mir-270(n4595) IV. Show Description
Deletion breakpoints are:AGTTTGGAAAACTGTGCTAGAATGAGAAAAGTTGCTGAAATGAT / GAAAAAGCG...TCGGACTTTA / CCCTTCGCCCCTTATCACACCATTCTATCAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14910 |
C. elegans |
pyp-1(n4599) IV/nT1 [qIs51] (IV;V). Show Description
n4599: C47E12.4 deletion from AA12F3.
|
|
| MT14935 |
C. elegans |
mir-59(n4604) IV. Show Description
Deletion breakpoints are: GAAATAAGGCTCTACAGT / ATGCTCAGACATAAATTA...ACGGTAGCTCCACGGGCAT / TTTAATGACAACTTACATAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14936 |
C. elegans |
mir-242(n4605) IV. Show Description
Deletion breakpoints are: GTACCTAGACAATATTCCT / CACCAACCTCAATTCAACAC...GGCTTAAGCTTAGGCGAATA / CAATCAATTTTTCAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15020 |
C. elegans |
mir-246(n4636) IV. Show Description
Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15021 |
C. elegans |
mir-78(n4637) IV. Show Description
Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15022 |
C. elegans |
mir-83(n4638) IV. Show Description
Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15024 |
C. elegans |
mir-58.1(n4640) IV. Show Description
Deletion breakpoints are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15025 |
C. elegans |
mir-269(n4641) IV. Show Description
Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15109 |
C. elegans |
lin-54(n3423) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
|
|
| MT1522 |
C. elegans |
ced-3(n717) IV. Show Description
Abnormal cell death. Cells that normally die survive.
|
|
| MT15454 |
C. elegans |
mir-243(n4759) IV. Show Description
Deletion breakpoints are:CAGAGATCGTGTGACAAT / GACGTTGACGCGAAGAAG.... GAGTAGTGTAATTTCCAATTTTTAT / AGATTAATTCAGGGGTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15501 |
C. elegans |
mir-83(n4638) IV. Show Description
Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15537 |
C. elegans |
unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X. Show Description
Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
|
|
