Search Strains

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10525 [ceh-14::TGF(8F2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10629 [F47H4.1::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10757 [alr-1::TGF(10A2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10655 [F21A10.2::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10695 [B0310.2::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10842 [egl-27b::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10845 [F21D5.9::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10867 [egl-5::TGF(7E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs80 [eor-1::TGF(9G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs87 [ceh-6::TGF(9H1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10813 [F16B12.6::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10877 [B0336.3::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10703 [ceh-26::TGF(10B1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs108 [fkh-4::TGF(11D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs94 [pal-1::TY1::eGFP::3xFLAG(P000006_G02)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs76 [unc-130::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

eGFP and 3xFLAG tags inserted into endogenous locus by CRISPR/Cas9.

Heterozygotes are WT and segregate WT, Unc, and Lethals. Lethal early larval. Balanced well. Maintain by picking WT.

Heterozygotes are Slow Uncs and segregate Slow Uncs, mid-larval lethals and severe Uncs. e1152 is a dominant Unc. let-49 also called med-47. SeeWBPaper00004990.

Heterozygotes are WT and segreate WT, Dpy Steriles, and lethals: arrested elongation at 2 fold; body wall muscle cells detach at embryonic stage when the muscle cells begin to contract - therefore, little embryonic movement is observed.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10079 [unc-54p::his-24::mCherry::let-858 3' UTR + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).

Less than 5% Muv animals.

gaIs27 [let-23::GFP + rol-6]. Maintain at 20 degrees.

Temperature sensitive. Nearly WT at 15C. At 20C the animals are 18% Muv and brood size is 88. At 25C the animals are 57% Muv and almost sterile (brood size is 6). Maintain at 15C.

Heterozygotes are Unc and express myo-2::GFP in the pharynx. spe-42(tn1231) homozygotes are non-Unc and non-GFP. spe-42(tn1231) produces <1 self progeny at 16C and no self progeny at 25C. The Spe defect can be rescued by WT sperm. Homozygous nT1[unc-?(n754) let-? qIs50] are embryonic lethal.

Heterozygotes are Unc and segregate Unc and WT which are Spe (they lay only oocytes on the plate). Maintain by picking Unc.

Heterozygote are fertile and Unc. spe-39(tx12) homozygotes are self-sterile due to defects in spermatogenesis.

Heterozygote are fertile and Unc. spe-39(eb9) homozygotes are self-sterile due to defects in spermatogenesis.

Heterozygotes are Unc and express myo-2::GFP in the pharynx. unc-42(e270) spe-42(eb5) homozygotes are Unc and non-GFP. Whle unc-42(e270) spe-42(eb5) self progeny have not been quantified, spe-42(eb5) alone produces 9 self progeny at 16C and <1 self progeny at 25C. The Spe defect can be rescued by WT sperm. Homozygous nT1[unc-?(n754) let-? qIs50] are embryonic lethal.

Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .

drop-1 a.k.a.- cyp-37A1. ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.

Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa

Class III supersized lipid droplet mutant. GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt

Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .

ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1.

sams-1 (a.k.a.- drop-4) Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.

emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.

Hets are WT and segregate WT, dead eggs, paralyzed DpyUnc and males. Maintain by picking WT.

Maintain strain by picking WT hermaphrodites. Segregates WT, dead eggs, paralysed DpyUnc and males.

Hets are WT and segregate WT, paralysed DpyUnc, L1 Lethal Unc-4s and males. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs, paralysed DpyUnc and males. Maintain by picking WT.

Het are WT and segregate WT, paralysed DpyUnc, and dead eggs. Maintain by picking WT.

Hets are WT and segregates WT, paralysed DpyUnc, and larvae which are arrested. Pick L1-L2 Unc-4's to check for larval lethal phenotype. Maintain strain by picking WT

Pick WT to maintain. Hets segregate WT, DpyUncs, and lethals (early larval arrest).

Hets are WT and segregate WT, paralysed DpyUncs, and dead eggs. Pick WT to maintain.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and paralysed DpyUnc. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and early larval lethals which are Unc. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and UncLets. Lethal early larval. Maintain by picking WT.