Strain Information
| Name | SOZ511 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | emb-8(ssd89) III. |
| Description | emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. |
| Mutagen | ENU |
| Outcrossed | x4 |
| Made by | Shaobing O. Zhang |
| Laboratory | SOZ |
| Reference | Li S, et al. (2016) A genetic screen for mutants with supersized lipid droplets in Caenorhabditis elegans. G3 (Bethesda) 6:2407–2419. Li S, et al. (2017) Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway.Proc Natl Acad Sci U S A. 114(33):8841-8846 |
Sign in
or
register an account if you want to order this strain.