Strain Information

Name SOZ511   View On Wormbase
Species C. elegans
Genotypeemb-8(ssd89) III.
Descriptionemb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.
MutagenENU
Outcrossedx4
Made byShaobing O. Zhang
Laboratory SOZ
Reference Li S, et al. (2016) A genetic screen for mutants with supersized lipid droplets in Caenorhabditis elegans. G3 (Bethesda) 6:2407–2419. Li S, et al. (2017) Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway.Proc Natl Acad Sci U S A. 114(33):8841-8846
Sign in or register an account if you want to order this strain.