Strain Information

Name SOZ0511   View On Wormbase
Species C. elegans
Genotypedrop-8/emb-8(ssd89)
DescriptionClass III supersized lipid droplet mutant. GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt
MutagenENU
Outcrossedx4
Made byShaobing O. Zhang
Laboratory SOZ
Reference Li S, et al. (2016) A genetic screen for mutants with supersized lipid droplets in Caenorhabditis elegans. G3 (Bethesda) 6:2407–2419. Li S, et al. (2017) Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway.Proc Natl Acad Sci U S A. 114(33):8841-8846
Sign in or register an account if you want to order this strain.