| ZM11207 |
C. elegans |
twk-40(bln336) III; hpIs860. Show Description
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. twk-40 gain-of-function allele. Paralyzed, no backward movement upon head touch. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA).
|
|
| ZM11208 |
C. elegans |
twk-40(hp834) III; hpIs860. Show Description
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Loopy movement with increased reversals. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA).
|
|
| ZM11284 |
C. elegans |
twk-40(bln336) III; hpEx4479. Show Description
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background.
|
|
| ZM11285 |
C. elegans |
twk-40(hp834) III; hpEx4479. Show Description
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(hp834) is a loss-of-function allele. Loopy. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background.
|
|
| ZM11286 |
C. elegans |
hpIs636; hpEx4479. Show Description
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites.
|
|
| ZM1385 |
C. elegans |
hpIs66. Show Description
hpIs66 [nab-1::GFP]. Reporter contains nab-1 genomic clone with 9 kb promoter sequence upstream of ATG, the entire nab-1 gene with GFP inserted immediately before the stop codon, and the 1 kb downstream sequence. Animals are slightly short with malformed tail in hermaphrodites. GFP localized in puncta at synapses in nerve cords and nerve ring. GFP localization also along the excretory canals, and some vulva expression. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
|
|
| ZM2246 |
C. elegans |
hpIs88. Show Description
hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
|
|
| ZM4624 |
C. elegans |
hpIs166. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.
|
|
| ZM4864 |
C. elegans |
daf-2(e1370) III; oxIs22. Show Description
oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
|
|
| ZM5016 |
C. elegans |
hpIs178. Show Description
hpIs178 [unc-17p::NpHR::GFP + lin-15(+)]. GFP expression in cholinergic neurons. Reference: Leifer AM, et al. Nat Methods. 2011 Feb;8(2):147-52. doi: 10.1038/nmeth.1554. PMID: 21240279.
|
|
| ZM5101 |
C. elegans |
hpIs193. Show Description
hpIs193 [nlf-1p::nlf-1::GFP + lin-15(+)]. GFP expression in head and tail neurons, as well as along ventral cord. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043
|
|
| ZM5488 |
C. elegans |
hpIs202. Show Description
hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
|
|
| ZM6686 |
C. elegans |
hpIs289. Show Description
hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
|
|
| ZM6725 |
C. elegans |
hpIs290. Show Description
hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
|
|
| ZM6804 |
C. elegans |
hpIs270. Show Description
hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
|
|
| ZM7055 |
C. elegans |
hpEx2999. Show Description
hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919
|
|
| ZM7212 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3088. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3088 [rgef-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
| ZM7646 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3197. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3197 [sto-6p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in cholinergic neurons to maintain. Body curvature becomes deeper in some transgenic animals. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
| ZM7648 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3195. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3195 [unc-25p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in GABAergic neurons to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
| ZM7656 |
C. elegans |
hpIs365. Show Description
hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZM7765 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3239. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3239 [lgc-55p::nca-1::GFP + nmr-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
| ZM8428 |
C. elegans |
hpIs459. Show Description
hpIs459 [unc-4p::GCaMP3::wCherry + lin-15(+)]. Strong GCaMP3 and wCherry expression in A-class motor neurons, as well as some head and tail neurons. It is recommended to use L4 stage animals when using this strain for calcium imaging and recording. Transgene expression becomes dimmer in many A-class neurons (except DA9), and is expression in VC neurons of adults. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
|
|
| ZM8561 |
C. elegans |
daf-2(m596) III; hpEx2906. Show Description
hpEx2906 [myo-2p::RFP + rgef-1p::daf-2]. Transgenic worms dauer easily. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
|
|
| ZM8562 |
C. elegans |
daf-2(m596) III; hpEx3369. Show Description
hpEx3369 [myo-2p::RFP + ges-1p(short)::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
|
|
| ZM8988 |
C. elegans |
daf-2(m596) III; hpEx2908. Show Description
hpEx2908 [myo-2p::RFP + dpy-30p::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
|
|
| ZM9028 |
C. elegans |
daf-2(m596) III; hpEx2905. Show Description
hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
|
|
| ZM9078 |
C. elegans |
hpIs587. Show Description
hpIs587 [flp-14p::GCaMP6::wCherry + lin-15(+)]. CGaMP6 and wCherry expressed in RID, ALA, some head neurons, a mid-body neuron and a tail neuron. Reference: Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
|
|
| ZM9354 |
C. elegans |
hpIs636. Show Description
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. mCherry expression in AVA soma and neurites along VNC. Non-specific mCherry expression in gut. HisCl activation leads to reduced forward and reversal activity.
|
|
| ZM9429 |
C. elegans |
zxIs6; ljIs131. Show Description
zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Body contracts and coils dorsally upon blue light illumination on ATR plates. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZM9519 |
C. elegans |
flp-14(gk1055) III; hpSi38; hpIs201. Show Description
hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
|
|
| ZM9551 |
C. elegans |
hpIs593; ljIs131. Show Description
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neuron activation and muscle relaxation upon illumination with green light. Muscle activity measured by GCaMP3. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZM9573 |
C. elegans |
unc-25(e156) III; zxIs6; ljIs131. Show Description
zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Cholinergic activation. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZM9585 |
C. elegans |
hpIs615; hpIs365. Show Description
hpIs615 [acr-2(s)p::Arch::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. A and B motor neurons are inhibited and body relaxes upon illumination with green light. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZT2 |
C. elegans |
drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.
|
|
| ZT22 |
C. elegans |
fjSi1 II; csr-1(fj54) IV. Show Description
fjSi1 [2×FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT24 |
C. elegans |
vsra-1(tm1637) I; fjSi3 II. Show Description
fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT29 |
C. elegans |
cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT3 |
C. elegans |
csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.
|
|
| ZT31 |
C. elegans |
cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. cec-4 cec-5 him-8 triple mutants exhibit partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. ok3124 deletion can be detceted by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC.
fj61 is a 444-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-5 (F32E10.6). The fj61 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT34 |
C. elegans |
cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT35 |
C. elegans |
cec-8(fj63) III; cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT56 |
C. elegans |
fjSi19 II; unc-119(ed3) III. Show Description
fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT62 |
C. elegans |
met-2(ok2307) set-25(n5021) III. Show Description
Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.
|
|
| ZT68 |
C. elegans |
csr-1(fj162) IV. Show Description
RNAi deficient (Rde). High incidence of males (Him). fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC.
|
|
| ZW129 |
C. elegans |
unc-68(r1162) V; zwIs108. Show Description
zwIs108 [myo-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Locomotion is similar to unc-68(r1162).
|
|
| ZW64 |
C. elegans |
unc-68(r1162) V; zwIs100. Show Description
zwIs100 [rab-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Larger and moves better than unc-68(r1162). Also called ZW64A.
|
|
| ZX460 |
C. elegans |
zxIs6 V. Show Description
zxIs6 [unc-17p::ChR2(H134R)::YFP + lin-15(+)] V.
|
|
| ZX679 |
C. elegans |
zxIs12. Show Description
zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter. When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.
|
|
| ZX819 |
C. elegans |
lite-1(ce314); zxIs12. Show Description
zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter (see also ZX679). When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. This strain is in lite-1(ce314) background, which eliminates the photophobic behavioral response that will be startled by blue light when longer light stimuli are used (>1s). To not confuse the photophobic behavior induced by LITE-1, with the PVD evoked escape behavior, this strain is needed for experiments with prolonged photostimulation. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.
|
|
| ZZ1 |
C. elegans |
lev-11(x1) I. Show Description
Levamisole resistant. Twitcher.
|
|