| VC1347 |
C. elegans |
K01H12.2(gk599) IV. Show Description
K01H12.2. External left primer: TCCGTGATATGTTGTTCCGA. External right primer: TCACCTCGATTCCACATGAA. Internal left primer: TGACTATGTGACGAAACGGC. Internal right primer: CGTTGCGGAATTCTTTGATT. Internal WT amplicon: 1650 bp. Deletion size: 533 bp. Deletion left flank: TAAGCGGCACGGTAGATGATGATACCTTGT. Deletion right flank: GTTCCTCCCGAGGCGAGATCAATCAAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1361 |
C. elegans |
F54F2.9(gk590) III. Show Description
F54F2.9. External left primer: AATCTCCGCTCAATTTGGTG. External right primer: AGGAAGATCGTTTGGCAATG. Internal left primer: ATTTCATCAAACCCGACCAA. Internal right primer: TGACTTTACCTCGCCGATCT. Internal WT amplicon: 2163 bp. Deletion size: 1049 bp. Deletion left flank: CTTCTCTGTTGAGCCAACTCCTCTTCTGTT. Deletion right flank: AAGGATATTAGGAAGGCAAGGAGAAGGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1444 |
C. elegans |
unc-42(gk598) V. Show Description
F58E6.10. External left primer: AAAGCGAAGCTCCTCCCTAC. External right primer: CCATCGAGGCAGTTCAAAAT. Internal left primer: GATCCGAAATTGGACGAAGA. Internal right primer: AAGGACGACGTCTGACAACC. Internal WT amplicon: 2097 bp. Deletion size: 1430 bp. Deletion left flank: TTTAGGATTGAACACACCAAGATCAGATCT. Deletion right flank: GTTAACGAAGAAATGTTTCCTAATTTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2437 |
C. elegans |
uaf-1(gk1036)/sC1 [dpy-1(s2170) let(gk597)] III. Show Description
Y92C3B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1- and lethal-marked recombination suppressor. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and gk1036 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGAAAGATGGATTTTTCGCA. External right primer: AAAATTCGTGAAAATTGCCG. Internal left primer: ATTTCTCGCTTCCACGACTG. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1125 bp. Deletion size: 606 bp. Deletion left flank: ATAGATTTTTGGCAAAGAAAATGAAAATTT. Deletion right flank: GGCGTTCAATATCTTCAAGTTTCATGCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3925 |
C. elegans |
cey-1(gk5004[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1155 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTCTCTTAATTACTACGAGTGTTACTGG; Right flanking sequence: CGGCTGTTACTTCGTGTGGCGCGACACAAC. See WormBase Variation gk5004 for details.
|
|
| VC3927 |
C. elegans |
dpyd-1(gk5006[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3743 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAAAACTTCATTTTCAATTTTTCAGACCT; Right flanking sequence: GGCCCATATGTCACACTCGACAACCAAGAG. See WormBase Variation gk5006 for details.
|
|
| VC3930 |
C. elegans |
twk-18(gk5009[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCATTCTGGGCGAATTTATGATTGCCAATA; Right flanking sequence: GAAGTTGTCCGTGTTGAGCATTTCAATCAC. See WormBase Variation gk5009 for details.
|
|
| VC3933 |
C. elegans |
R01B10.6(gk5008[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1561 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAAAGGCAAAGTAGAAAATGACCAGCGAG; Right flanking sequence: ATAGGAAAACAAATATTGTTAAAAAATTTA. See WormBase Variation gk5008 for details.
|
|
| VC3937 |
C. elegans |
B0205.12(gk5015[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTAAAATATGGGTCTCTTCTCGCATCTCCT; Right flanking sequence: TGGAAGACTATCTGAAGCAATACAAAAAGG. See WormBase Variation gk5015 for details.
|
|
| VC3940 |
C. elegans |
Y57G11A.5(gk5018[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1099 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCAGTTTTTACACTTTTAAATATGTTA; Right flanking sequence: GGGTACTTGGTTGTCAGAGCTATTGCTTTT. See WormBase Variation gk5018 for details.
|
|
| VC3942 |
C. elegans |
col-128(gk5030) IV. Show Description
Homozygous viable. Splicing defect identified by amplicon sequencing.
|
|
| VC3945 |
C. elegans |
F12A10.8(gk5033) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
|
|
| VC3946 |
C. elegans |
F15D4.2(gk5020[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 449 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGTGGGAAGCTGTCGAGGTGCTGATGCCA; Right flanking sequence: TGGAAGAGGATCTTGAAGATTTTCTCTAAA. See WormBase Variation gk5020 for details.
|
|
| VC3948 |
C. elegans |
C37A2.8(gk5022[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1524 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCACCAATAATCTTGTATCATCATTCACCA; Right flanking sequence: TCTTCCTCCGTCAATTCACGTGACGCAAAT. See WormBase Variation gk5022 for details.
|
|
| VC3949 |
C. elegans |
F17C8.9(gk5023[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1071 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACACTTTTTACAGGAAAATTTCTTGTCGA; Right flanking sequence: GGAGCTCTTGCGGCAAGCAATTTAGGATTT. See WormBase Variation gk5023 for details.
|
|
| VC3950 |
C. elegans |
ugt-9(gk5024[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGTTTTCGGAAGGCTTTCTGTAGGGTGAA; Right flanking sequence: GGAGGTGCTGTTGCGTACGACAAATTTGAT. See WormBase Variation gk5024 for details.
|
|
| VC3956 |
C. elegans |
F10C1.9(gk5034[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1139 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAACAAATAATTAGCTGCCTCATTGCCT; Right flanking sequence: CATTTCATGTTCCATCACAGCCATATCGCT. See WormBase Variation gk5034 for details.
|
|
| VC3958 |
C. elegans |
asd-2(gk5036[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3065 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTTGAACCCGAACCCGCAAGCACCACCC; Right flanking sequence: GGTGGGAGAACCAGAAACGTGTAAATCGAC. See WormBase Variation gk5036 for details.
|
|
| VC3959 |
C. elegans |
ubc-7(gk5037[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 551 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TATTTCGGTTATTTTTCATTGTTTAGACGA; Right flanking sequence: TAGGGAGGATTGCTCCATCTATCTAGAAAT. See WormBase Variation gk5037 for details.
|
|
| VC3961 |
C. elegans |
C49A9.10(gk5039[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCTGGCTTTTTTCTTGTTCCAAGTGCCG; Right flanking sequence: CACCGTGCTGGTTCTCGGCCATTTGGTGGG. See WormBase Variation gk5039 for details.
|
|
| VC3962 |
C. elegans |
K07H8.9(gk5040[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAAACAAAGATAATGATGAGCACCGGGAA; Right flanking sequence: GTCGGATAGCTGCAAAAAAACAGATAACTG. See WormBase Variation gk5040 for details.
|
|
| VC3964 |
C. elegans |
aps-3(gk5047) I; C17C3.3(gk5048) II. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
|
|
| VC3965 |
C. elegans |
clec-118(gk5049) C17C3.3(gk5048) II. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
|
|
| VC3966 |
C. elegans |
Y57G11C.36(gk5042[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1197 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCCGAAAAGATGGGAATTGGCGATACGGA; Right flanking sequence: tcaggcagaagatgactctgaaattaaaaa. See WormBase Variation gk5042 for details.
|
|
| VC3967 |
C. elegans |
Y69A2AR.32(gk5043[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGAAACAATGATAATTATCACGATCAAC; Right flanking sequence: CTGATGTCCACTCCGATGCCGCCTCCAGGA. See WormBase Variation gk5043 for details.
|
|
| VC3973 |
C. elegans |
zipt-13(gk5051[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGTCAGAGCAATGTTGAGAAATCCTCCT; Right flanking sequence: GTCCTTGTTGAGCATGTATCGCAATGCAAG. See WormBase Variation gk5051 for details.
|
|
| VC3974 |
C. elegans |
C06G4.1(gk5052[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2869 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGACAAATCGATATTTGTATCCAGCG; Right flanking sequence: TCTTCCAAGTTCGTGTTCCAGAAAACATGG. See WormBase Variation gk5052 for details.
|
|
| VC3975 |
C. elegans |
+/nT1 IV; sas-5(gk5038[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 1442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAGCTTCCACAAGAAAGGACAAAACCCC; Right flanking sequence: GGTACCTGAGACTCCAGCTGAACGAGAACG. See WormBase Variation gk5038 for details.
|
|
| VC3977 |
C. elegans |
C48B6.3(gk5054[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 801 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGAGCTGTTCTTCGAGAACTGGCGGTGCCC; Right flanking sequence: AAATAACTCAACGACATCTCCAACGTCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC3979 |
C. elegans |
ZK185.5(gk5056[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGTTTACTTTTCTTGGTTTAATCACTTT; Right flanking sequence: CGCCTGATAATCTTCTAAAACTTTGAACAG. See WormBase Variation gk5056 for details.
|
|
| VC3981 |
C. elegans |
F59G1.4(gk5058[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTACAATAGAGTTCCACTAACGCCAACT; Right flanking sequence: TTTGGTAATTTGCCAAAATTCGACGGTCAT. See WormBase Variation gk5058 for details.
|
|
| VC3983 |
C. elegans |
mrps-26(gk5010[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details.
|
|
| VC3985 |
C. elegans |
cfim-2(gk5017[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 2670 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTTTGAGGATTGATGGCTGAATTGGAC; Right flanking sequence: ATTAAATAACACGACTTTCTTCAAATTCAA. See WormBase Variation gk5017 for details.
|
|
| VC3986 |
C. elegans |
Y18D10A.9(gk5013[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hIn1[unc-101(sy241)] I . Show Description
Recessive lethal deletion balanced by hIn1. Deletion of 4986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAATTTCGGATTCGGGTTCCATGCCA; Right flanking sequence: GTCTGAAAATTGAAAATAAATTTAAAAACT. See WormBase Variation gk5013 for details.
|
|
| VC3988 |
C. elegans |
H04D03.3(gk5060[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2070 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTCCGATTTAAAACTGTCTCTTCCTCTA; Right flanking sequence: CTGGTCATGTTTTTCGAATATTCCACAATT. See WormBase Variation gk5060 for details.
|
|
| VC3992 |
C. elegans |
lron-10(gk5064[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2073 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGCACTGAACCAGCTTTTCGCCGCCT; Right flanking sequence: GATGGAGGTCATGCCTAAACGAAACAAAAA. See WormBase Variation gk5064 for details.
|
|
| VC3994 |
C. elegans |
F25H2.3(gk5066[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCACAATTACGATCAGGTTTTATGTATG; Right flanking sequence: TATTTTTAGAGATCTTCAAACGAAGATCAG. See WormBase Variation gk5066 for details.
|
|
| VC3996 |
C. elegans |
lron-6(gk5068[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1960 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACAGACCACTCAACATAGCCATCACTTCG; Right flanking sequence: TGATACCGTGTGCTTGAGCATGAAGTGGAT. See WormBase Variation gk5068 for details.
|
|
| VC4000 |
C. elegans |
oig-5(gk5072[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTTCTCTGGTGGTAGCGATGATGGTAGAA; Right flanking sequence: GGCTGAAATCAATGCGTGGTAGCCTAAAGA. See WormBase Variation gk5072 for details.
|
|
| VC4001 |
C. elegans |
Y55F3AM.11(gk5073) IV. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
|
|
| VC4002 |
C. elegans |
C06E2.9(gk5074) C05G5.3(gk5075) X. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
|
|
| VC4003 |
C. elegans |
F54D1.1(gk5076[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCAAGTCAATATTTTCATTATTTCCTCAT; Right flanking sequence: ATTTGTTACTGAAATCTCAGATAACAATGC. See WormBase Variation gk5076 for details.
|
|
| VC4006 |
C. elegans |
igeg-1(gk5079[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4007 |
C. elegans |
igeg-2(gk5080[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1974 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGCTATTGTGTCACCGTTCCTCTGTCCA ; Right flanking sequence: ACAGGAATGAGGGAGTGTCAAGGAAAAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4008 |
C. elegans |
lron-1(gk5081[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3289 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGATCACTCATTTCCTTATTCTTTCCAGGT; Right flanking sequence: TTTGGTTTCCTATCCCTTTTCAACAAATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4009 |
C. elegans |
H28G03.1(gk5082[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1570 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATATTGTTCTTCACGCCAGGTCTACAA; Right flanking sequence: GGAGGTACCACAACGGAGGTAAATTTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4018 |
C. elegans |
ZK616.1(gk5090[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2060 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATTTATTCCTGTTTCACTACATCATGAT ; Right flanking sequence: ACACTCCGTTTTGAACGTAGAAAAGTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4020 |
C. elegans |
R09B3.2(gk5093[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 621 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ACCCGATATGAAGATCAACTTATTTGTTGG ; Right flanking sequence: TTTGGCCCCGCCCCTCGAATAGCATCGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4022 |
C. elegans |
lgc-6(gk5095[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGGTTACAATAACTCCAAATACATTTATT ; Right flanking sequence: CTTCCCATAGACCTACATTCTGACACCGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4024 |
C. elegans |
lgc-13(gk5097[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2024 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATGAAAAAGATGTCTCTCCCGTGTATG ; Right flanking sequence: GCATTGGGCAATCTCATGTTTCATTTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|