| GW76 |
C. elegans |
gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. [NOTE: transgene seems prone to silencing. Pick RFP+ to maintain.] Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364
|
|
| GW829 |
C. elegans |
gwIs39 III; cec-4(ok3124) IV; gwIs4 X. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. PMID: 26607792
|
|
| GW833 |
C. elegans |
cec-4(ok3124) IV; gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
|
|
| GW996 |
C. elegans |
gwSi17 set-4(n4600) II; met-2(n4256) set-25(n5021) III; gwIs4 X. Show Description
gwSi17 [cec?4p::cec?4::WmCherry::cec?4 3'UTR] II. gwIs4 [baf-1p::GFP-lacI::let-858 3UTR + myo-3p::RFP] X. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage). CEC-4::WmCherry is visible at the nuclear periphery in embryos and L1 stage animals. Reference: Cabianca DS, et al. Nature 2019 May;569(7758):734-739. PMID: 31118512
|
|
| HA2823 |
C.elegans |
smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. Show Description
nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
|
|
| HA2825 |
C.elegans |
smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. Show Description
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
|
|
| HT1881 |
C. elegans |
daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HT1888 |
C. elegans |
daf-16(mgDf50) I; unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Over-expresses daf-16a. Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HZ769 |
C. elegans |
him-5(e1490) V; bpIs88. Show Description
bpIs88 [tia-1p::tia-1::GFP + dcap-1p::dcap-1::RFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.
|
|
| IC459 |
C. elegans |
sax-3(ky123) X; quEx102. Show Description
quEx102[F25B3.3::SAX-3 + odr-1::RFP]. F25B3.3::SAX-3 partially rescues the lethality and notch phenotype of sax-3(ky123). Maintain by picking RFP+.
|
|
| IC464 |
C. elegans |
sax-3(ky123) X; quEx100. Show Description
quEx100 [ajm-1::sax-3 + odr-1::RFP]. ajm-1::sax-3 partially rescues the lethality of sax-3(ky123). Maintain by picking RFP+.
|
|
| IC476 |
C. elegans |
sax-3(ky123) X; quEx99. Show Description
quEx99 [sax-3(minigene) + odr-1::RFP]. Rescues the lethality of ky123. Pick RFP+ to maintain.
|
|
| IC699 |
C. elegans |
sax-3(ky123) ; quEx168. Show Description
quEx168 [sax-3::GFP + odr-1::RFP]. Pick RFP+ to maintain. GFP is visible at higher magnification but fades quickly. Strongest GFP is in the head region. The Chin-Sang Lab recommends researchers use this strain instead of IC450, as sax-3::GFP expression in IC699 is more consistent than in the comparable strain IC450.
|
|
| IC765 |
C. elegans |
npr-9(tm1652) X; quEx182. Show Description
quEx182 [npr-9(+) + sur-5::GFP + odr-1::RFP]. Maintain by picking GFP+. Rescuing npr genomic fragment co-injected with sur-5::GFP and odr-1::RFP]. transgenic (GFP+) animals tend to wander off the food.
|
|
| IK716 |
C. elegans |
njIs11. Show Description
njIs11[glr-3p::GFP + ges-1p::RFP]. RIA interneurons express soluble GFP.
|
|
| IK718 |
C. elegans |
njIs12. Show Description
njIs12[glr-3p::glr-1::GFP + glr-3p::RFP + ges-1p::RFP]. RIA interneurons express soluble GFP.
|
|
| JH3308 |
C elegans |
gtbp-1(ax5000[gtbp-1::tagRFP]) IV. Show Description
tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.
|
|
| JH3562 |
C. elegans |
gtbp-1(ax5000[gtbp-1::tagRFP]) IV; meg-3(ax3054[meg-3::meGFP]) X. Show Description
tagRFP tag inserted into endogenous gtbp-1 locus. meGFP tag inserted between P121 and V122 of endogenous MEG-3. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.
|
|
| JLF173 |
C. elegans |
gip-1(wow25[tagRFP-T::3xMyc::gip-1]) zif-1(gk117) III. Show Description
tagRFP-T and 3xMyc tags inserted into endogenous gip-1 locus. No overt phenotypes. RFP fluorescence is observed at microtubule-organizing centers, though generally much dimmer than the GFP allele gip-1(wow3). Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF425 |
C. elegans |
spd-5(wow36[tagRFP-T::spd-5]) spd-2(wow60[spd-2::GFP::3xFlag]) I. Show Description
tagRFP-T tag inserted into endogenous spd-5 locus. GFP and 3xFLAG tags inserted into endogenous spd-2 locus. No overt phenotypes. GFP and RFP fluorescence is observed at centrosomes. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
|
|
| JN3038 |
C. elegans |
qjIs11; peIs3042; peIs2100; qjIs14. Show Description
qjIs11 [glr-1p::SVNLS2::TagBFPsyn + ser-2(prom2)::SVNLS2::TagBFPsyn]. peIs3042 [eat-4p::svnls2::TagRFP675syn + lin-44p::GFP]. peIs2100 [H-20p::NLS4::mCherry]. qjIs14 [H20p::NLS::YC2.60]. Suitable for whole-brain calcium imaging. mCherry and YC2.60 expression in almost all head neurons. BFP and RFP are also expressed to annotate neurons. H20p is a pan-neuronal promoter expressed in almost all neurons, GLR glial cells, XXX hypodermal cells, pharyngeal gland cells and HMC cells. Reference: Toyoshima Y et al. BMC Biol. 2020 Mar 19;18(1):30. PMID: 32188430; Shioi G, et al. Genetics. 2001 Apr;157(4):1611-22. PMID: 11290717.
|
|
| JN785 |
C. elegans |
peIs785. Show Description
peIs785 [casy-1p::daf-2 E11-E11.5(+c)-E12::EGFP + casy-1p::daf-2 E11-E11.5(+c)-E12(-c)::mRFP]. peIs785 caries a daf-2 splicing reporter expressed in many neurons. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602
|
|
| JUP1 |
C. elegans |
oxSi120 II; him-8(e1489) IV. Show Description
oxSi120 [peel-1p::tagRFP::MSP-142 3'utr+ unc-119(+)]. Him. Derived from EG5897 and CB1489; not known if is unc-119(ed3) is still present in background. Reference: Batchelder EL, et al. Proc Natl Acad Sci U S A. 2011 Jul 12;108(28):11429-34.
|
|
| KDK53250 |
C. elegans |
oskEx53250. Show Description
oskEx53250 [dat-1p::GCaMP6f + dat-1p::mCherry + lin-44p::mRFP + N2 genomic DNA cut with Pvu II (as a carrier)]. Pick animals with red fluorescence to maintain. GCaMP6f and mCherry expressed in dopaminergic neurons. Generated in N2 background. Reference: Tanimoto Y, et al. Sci Rep. 2016 May 19;6:26297. doi: 10.1038/srep26297. PMID: 27193056.
|
|
| KG2430 |
C. elegans |
ceIs56 X. Show Description
ceIs56 [unc-129p::ctns-1::mCherry + nlp-21p::Venus + ttx-3p::RFP]; Maps to X: 9.0 +/ 3.0 m.u. Expresses the lysosomal membrane marker CTNS-1 in a subset of 9 DA/DB cholinergic motor neurons in the ventral cord, and NLP-21::Venus in the same neurons as a marker for soluble DCV cargo and to help identify the boundaries of the somas and axons when imaging lysosomes. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. Genetics. 2015 Sep;201(1):117-41.
|
|
| KG4247 |
C. elegans |
ceIs201 I. Show Description
ceIs201 [unc-17p::ins-22::Venus + unc-17p::RFP + unc-17p::ssmCherry + myo-2p::RFP]; integration site maps to I:0.77. Expresses INS-22::Venus to mark Dense Core Vesicles in the cholinergic nervous system, including the ventral cord cholinergic motor neurons. Also expresses mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. ssmCherry is mCherry with a secretion signal on its N-terminus, which is constitutively secreted and taken up by coelomoctyes in the pseuodcoelomic space, making it a useful marker for those coelomocytes. The INS-22::Venus also gets secreted by DCVs and taken up by coelomocytes. The myo-2::RFP is a co-tranformation marker that lights up the pharyngeal muscle cells and is useful for crossing the integrant into various mutant backgrounds. Reference: Hoover CM, et al. Genetics. 2014 Mar;196(3):745-65.
|
|
| KG4671 |
C. elegans |
ceIs259 IV. Show Description
ceIs259 [unc-129p::RFP::syn-13 + unc-129p::Venus + ttx-3p::RFP]; Inserted at center of LG IV. Expresses RFP::SYN-13 to mark early endosomes in a set of 9 DA/DB cholinergic motor neurons in the ventral nerve cord. unc-129::Venus fills the neuron and thus is useful for identifying regions and can also be used as a control for effects on expression of the transgene. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. (manuscript in revision). "Sentryn Acts with a Subset of Active Zone Proteins in the Guided Transport and Capture of Synaptic Vesicles in Caenorhabditis elegans."
|
|
| KG4687 |
C. elegans |
ceIs269 I. Show Description
ceIs269 [unc-129p::tomm-20::Venus + unc-129p::mCherry + ttx-3p::RFP]; Integration in Chromosome I (near genetic position -3.20 or 1.14). The ttx-3 marker is quite faint in this strain especially in larvae. The tomm-20::Venus construct was injected at 0.5 ng/ ul in the strain used to make this integrant, so virtually all of the visible tomm-20::Venus signal s associated with mitochondria with essentially no background. The unc-129p::mCherry marker is expressed at a very low level that are detectable only with a sensitive camera (and often not by eye at 1000X). In strains lacking mitochondria in the dorsal cord, use the camera to focus on the mCherry in the dorsal cord, then acquire in the YFP channel.
|
|
| KG5082 |
C. elegans |
ceIs308. Show Description
ceIs308 [mig-13p::ins-22::Emerald + mig-13p::mCherry + odr-1p::RFP]; Linked to IVC (ceP86; 3.37): 0/17 recombinants. Expresses INS-22::Emerald to mark Dense Core Vesicles in the the DA9 and VA12 cholinergic motor neurons, and also mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. Useful for visualizing Dense Core Vesicles in a single, well-segregated neuron in living animals. When picking homozygotes from crosses with other strains, focus on the brightness of the RFP puncta in the cord. Autofluorescence in the worm body can make it difficult to gauge differences in brightness of the odr-1::RFP marker. Reference: Edwards SL, et al. (manuscript in revision). "Sentryn Acts with a Subset of Active Zone Proteins in the Guided Transport and Capture of Synaptic Vesicles in Caenorhabditis elegans."
|
|
| KH1125 |
C. elegans |
asd-1(yb978) III; ybIs733. Show Description
ybIs733 [myo-3::egl-15::BGAR + lin-15(+)]. GFP/RFP chimeric expression of egl-15::BGAR reporter in body wall muscles.
|
|
| KP3814 |
C. elegans |
nuIs152 II. Show Description
nuIs152 [unc-129p::GFP::snb-1 + ttx-3p::mRFP] II.
|
|
| KRA235 |
C. elegans |
pha-1(e2123) III; kasEx80. Show Description
kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
|
|
| KRA582 |
C. elegans |
pha-1(e2123) III; kasEx271. Show Description
kasEx271 [pxd-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with pxd-1 genomic region (-2,165 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KRA584 |
C. elegans |
pha-1(e2123) III; kasEx273. Show Description
kasEx273 [cal-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with cal-2 genomic region (-3,326 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KRA586 |
C. elegans |
pha-1(e2123) III; kasEx275. Show Description
kasEx275 [lgc-4::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with lgc-4 genomic region (-669 to +1,797 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KRA588 |
C. elegans |
pha-1(e2123) III; kasEx277. Show Description
kasEx277 [ldb-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with ldb-1 genomic region (+1,063 to +4,393 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KRA590 |
C. elegans |
pha-1(e2123) III; kasEx279. Show Description
kasEx279 [nep-21::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with nep-21 genomic region (-3,471 to -865 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KRA592 |
C. elegans |
pha-1(e2123) III; kasEx281. Show Description
kasEx281 [D2007.2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with D2007.2 genomic region (-2,997 to -517 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KRA594 |
C. elegans |
pha-1(e2123) III; kasEx283. Show Description
kasEx283 [dmsr-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with dmsr-2 genomic region (-3,452 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KRA595 |
C. elegans |
pha-1(e2123) III; kasEx284. Show Description
kasEx284 [ncs-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with ncs-2 genomic region (-3,455 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KRA597 |
C. elegans |
pha-1(e2123) III; kasEx286. Show Description
kasEx286 [npr-29::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with npr-29 genomic region (-9,810 to -6,028 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KRA599 |
C. elegans |
pha-1(e2123) III; kasEx288. Show Description
kasEx288 [drn-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with drn-1 genomic region (-6,346 to -4,825 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
|
|
| KW2088 |
C. elegans |
cdk-12(tm3846)/qC1 [dpy-19(e1259) glp-1(q339)] nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT RFP+ and segregate WT RFP+, Dpy Sterile RFP+ , and tm3846 homozygotes (Emb). Reference: Bowman EA, et al. Development. (In Press).
|
|
| LE2791 |
C. elegans |
lqIs170 X. Show Description
lqIs170 [F25B3.3p::vab-10(ABD)::GFP + ttx-3::RFP] X. Pan-neuronal GFP expression. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.
|
|
| LP193 |
C. elegans |
cpIs56 II; unc-119(ed3) III. Show Description
cpIs56 [mex-5p::TagRFP-T::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
|
|
| LW2286 |
C. elegans |
lon-2(e678) X; jjIs2277. Show Description
jjIs2277 [pCXT51(5*RLR::pes-10p(deleted)::GFP) + LiuFD61(mec-7p::RFP)]; integrated on LG I or IV. Reference: Tian et al. (2010) Development 137(14):2375-84.
|
|
| LW2308 |
C. elegans |
dbl-1(wk70) V; jjIs2277. Show Description
jjIs2277 [pCXT51(5*RLR::pes-10p(deleted)::GFP) + LiuFD61(mec-7p::RFP)]; integrated on LG I or IV. Reference: Tian et al. (2010) Development 137(14):2375-84.
|
|
| LW2436 |
C. elegans |
jjIs2277. Show Description
jjIs2277 [pCXT51(5*RLR::pes-10p(deleted)::GFP) + LiuFD61(mec-7p::RFP)]; integrated on LG I or IV. Reference: Tian et al. (2010) Development 137(14):2375-84.
|
|
| LX811 |
C. elegans |
vsIs33 V; lin-15B&lin-15A(n765) X. Show Description
vsIs33 [dop-3::RFP] V.
|
|
| LX831 |
C. elegans |
vsIs33 V; lin-15B&lin-15A(n765) X; vsIs28. Show Description
vsIs28 [dop-1::GFP]. vsIs33 [dop-3::RFP] V. Integration sites not known.
|
|