More Fields
Strain Species Genotype
RG3173 C. elegans Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 Show Description
Homozygous sterile. Deletion of 1965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults(ve673 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ggaaTCACTTGGTCACTTGTGTAGTATCAC ; Right flanking sequence: aggaatatcacgaaaaaatgcgaaatttgg. sgRNA #1: GCATTTGAATGGAGCGGAGC; sgRNA #2: ccaaaaatgcaatttcagcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.