staIs2 [pie-1p::rbr-2::GFP + unc-119(+)]. Extended longevity. Maintain under normal conditions. Reference: This strain was used as LC Ppie-1::rbr-2::GFP (#3) in Greer EL et al Nature 2010 doi: 10.1038/nature09195.

Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line.

Animals with the Duplications are WT. Animals which have lost the Duplication are Sterile and have an abnormal tail.

sEx15263 [rCes Y40B1B.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15307 [rCes Y43F4B.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Expresses GFP in pharyngeal muscles. Single-copy insertion in the MosSCI locus cxTi10882 on chromosome IV. Obtained via the outcrossing of strain BN578 with N2. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germline granules defective, ~30% sterility. Males fail to be attracted by hermaphrodite-secreted volatile sex pheromones. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. gfp fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germ granule defective, ~30 sterility. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343

Unc. Tail abnormalities-twisted or knobbed. Recessive. M-MATING-NO SUCCESS.

Dpy. Recessive. M-MATING+POOR <1%WT.

Hermaphrodites are Dpy. Males are non-Dpy and have abnormal bursae in adult, with swollen rays. Males will mate, but with very low efficiency. [3/98: King Chow isolated a line from the CGC stock that was throwing 100% Mabs. Sent the strain back to the CGC to replace the old stock.]

Unc.

muEx248 [(pNL209) daf-16::GFP::daf-16(cDNA) + podr-1::RFP]. Pick green (body) / red (head neurons) animals. Transmission efficiency ~50%. Can be grown at 20C with some sterility (30-50%). The higher the temperture, the greater the sterility.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.

adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57.

adEx2149 [odr-3p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.

adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.

Linkage mapping strain. Maintain at 15C.

Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.

Temperature sensitive. Egg lethal. Gon phenotype if shifted to 25C early. Maternal effect (m,m).

raEx245 [T05G5.1p::Y40B1B.7 ORF(cDNA)::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx273 [T05G5.1p::Y17G7B.7(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

oxTi993 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:25.92). Insertion into Y105E8B.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

Temperature sensitive. Maintain at 15C. pha-1(e2123) is embryonic lethal at 25C. Hermaphrodites have an abnormal tail: sometimes twisted, tail whip never formed, often bobbed; sometimes uncoordinated with bent tail. Adult male tail deformed also.

Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3'

Dominant ts maternal-effect embryonic lethal. Embryos arrest prior to morphogenesis or at two-fold. Non-ts recessive mid-larval lethal. Maintain at 15C. Freezes poorly.

Unc.

egl-27(we3) animals have variable body morphology defects with cold sensitive embryonic/L1 lethality (5% die at 22C, 90% at 15C). Maternal effect vab-7(ed6) enhancer; semi-lethal with vab-7(ed6).

qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282

uaEx27 [(p016bA443F) nuo-1(+) + unc-119(+)]. Contains an extrachromosomal array carrying nuo-1(A443F) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Low brood size. Short life span. Sensitive to oxidative stress.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Approx. 50% sterility at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

Brood size slightly reduced at 25 degrees. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

nhl-2(cdb100) contains engineered mutations in the mir-35 binding site in the nhl-2 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the egl-1 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Slightly reduced brood size at 25C. Reference: Donnelly BF, et al. (2022). Cell Reports.

Superficially wild-type. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Temperature sensitive egg lethal. Maintain at 15C. Will grow at 20C, and a few leak through at 25.4C.

cdIs141[pcc1::mCherry::rab-7 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter.

cdIs66 [pcc1::GFP::rab-7 + myo-2p::GFP + unc-119(+)]. GFP::rab-7 expressed in front of coelomocyte promoter.

Temperature-sensitive maternal effect lethal; ~50% of embryos fail to hatch at 25 C. Maintain at 15-20 C. Reference: Kemp et al. (2007) Genetics 176:95-113.

Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous vab-7 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms.

Y71F9B.7 Homozygous. Outer Left Sequence: aacgaggtgaatcggatttg. Outer Right Sequence: ttttgtgtccttttcccgtc. Inner Left Sequence: cccgaatgtttgttcgttct. Inner Right Sequence: atttcttttcgccgtgtgac. Inner Primer PCR Length: 2714. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71H2B.7. Homozygous. Outer Left Sequence: GCCTCCTCAATCCTCAATCA. Outer Right Sequence: TTCCAGTACACAATCGCCTG. Inner Left Sequence: GAAGACGGCAATGATACGGT. Inner Right Sequence: TTGAGCATCAGTTGCCTGAG. Inner Primer PCR Length: 2552 bp. Deletion Size: 1693 bp. Deletion left flank: TTTCCAATTAGTGGTGGTGATTTTTGCCTG. Deletion right flank: AGGGAAAAAAGGGAAAACCGGAGAATTATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs63 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

Homozygous sterile. Deletion of 1965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults(ve673 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ggaaTCACTTGGTCACTTGTGTAGTATCAC ; Right flanking sequence: aggaatatcacgaaaaaatgcgaaatttgg. sgRNA #1: GCATTTGAATGGAGCGGAGC; sgRNA #2: ccaaaaatgcaatttcagcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.