| UDN100083 |
C. elegans |
unc-116(udn45)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick slightly dumpy GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate slightly dumpy GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), non-GFP udn45 homozygotes (early larval arrest and Unc), and a few slow-growing wild-type looking or thin GFP+ heterozygotes. These thin GFP+ animals give rise to almost exclusively GFP+ progeny; a possible interaction between unb45 and qC1 is suspected. Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.
|
|
| UDN100169 |
C. elegans |
unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.
|
|
| VB1605 |
C.elegans |
svIs69. Show Description
svIs69 [daf-28p::daf-28::GFP + unc-4(+)]. Derived from injection of pVB298gk (daf-28p::daf-28::GFP) with unc-4(+) into unc-4(e120). unc-4(e120) was likely removed during out-crossing, but might still be in background.
|
|
| VC10002 |
C. elegans |
bli-2(e768) F10E7.2&spon-1&F10E7.11(gk460) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F10E7.2, F10E7.4, F10E7.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk460 homozygotes (probable embryonic arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AACAATGTTTGGTCCATCCC. External right primer: ACACCAGGTTGACCTCCTTG. Internal left primer: ATGAGCCCAAATGAACCAAC. Internal right primer: AATAGGCACAATACGCCTGC. Internal WT PCR product: 5051. Deletion size: 4507 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10005 |
C. elegans |
ast-1(gk463) bli-2(e768) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk463 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10007 |
C. elegans |
bli-2(e768) C06A8.1(gk465) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C06A8.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk465 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTGCAATCGGAGTGGTTTC. External right primer: GGGAATCATGCCAATTATGG. Internal left primer: GGTCATGAAGCATTCGAGGT. Internal right primer: GAACAGAGCGTTGCATTGAA. Internal WT PCR product: 718. Deletion size: 141 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10067 |
C. elegans |
F31D5.1(gk770) gkDf13 unc-4(e120) II. Show Description
This strain is homozygous for two deletions plus unc-4(e120). The deletions were identified by comparative genome hybridization (CGH) of a mutangenized unc-4 line against N2. The deletion gk770 was confirmed by PCR and sequencing of the amplification product, and is detectable using the following primers. Left primer: GCGCATTTGCAACATCTCTA. Right primer: AACCTCAACGGAAACACTGG. WT amplicon: 1087 bp. Deletion size: 142 bp. Deletion left flank: CAGGTGAGCTTAAGCAGATTTTTTTTTGAA. Deletion right flank: GTGAGCCAAGTTAAACATTTGAAAATAATT. Insertion Sequence: GTGAGCCAAGTTGAACATTTGAAAATAAT. The deletion gkDf13 was not confirmed by PCR. CGH data indicates a maximum size of 7801 bp and a minimum size of 1357 bp. Left flanking probe: GTTTTATCTTTCGGCTTATTCAGAATAAATTATTGGTTCAGTTGTTTCAG. Left deleted probe: AGGAGAAGGAGATAAATGGTCTTGTAGACTGCGCAGCTAGGGAGAGAGAA. Right deleted probe: GAAGTTCTGAAGATTCAATTTTCAGTCTTACAATATTCAGTTCTCGTGTA. Right flanking probe: GTTGAATTTATTCGAATTTTGCAATTTCAGCAAAACACCTTTATCTTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10068 |
C. elegans |
unc-4(e120) sre-29(gk771) II. Show Description
F57G9.4. Unc. External left primer: GACCTGAAATTGCTGGGAAA. External right primer: GGAAACTCACAAATTGCCGT. External WT amplicon: 1532 bp. Deletion size: 161 bp. Deletion left flank: CCCTCTCCACCGCAATTGCAAGAACTCCAA. Deletion right flank: GCTATAGTAATCAATTTTCCAATTATAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10070 |
C. elegans |
K05F1(gk773) unc-4(e120) II. Show Description
K05F1. Unc. External left primer: GTATGGTCCGTCGCAAGAAT. External right primer: CTGATGACGGTTTTCCTGGT. External WT amplicon: 1653 bp. Deletion size: 490 bp. Deletion left flank: CCGCCAAATTTGGCGGTTTCTGAGACCTTG. Deletion right flank: CTCGCATACGCTTGAAACTTACAGCGTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10071 |
C. elegans |
srb-16(gk774) unc-4(e120) II. Show Description
F58A6.6. Unc. External left primer: AAGTGGTTTTGGGTCTGACG. External right primer: GTACCGCCGCAAGAATGTAT. Internal left primer: GCCGCCACGAGTTAATAGAA. Internal right primer: TGTTGGCCCTGATTTCTTTC. Internal WT amplicon: 4857 bp. Deletion size: 3522 bp. Deletion left flank: ACGATTTTTGCACAAAAAACCCCTCCAAAC. Deletion right flank: GTCGTTTGCTTGTTTCATCTTCATCATTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10072 |
C. elegans |
cpna-2(gk775) unc-4(e120) II. Show Description
B0228.4. Unc. External left primer: GCTCAAAGCTCCGAAACAAC. External right primer: CCCACAAGATTGGTAAGCGT. External WT amplicon: 876 bp. Deletion size: 153 bp. Deletion left flank: AGTTAGACACACTGAAAATGCTGGAAAGGT. Deletion right flank: CAGAAGCCTTGCTCCGTCGGCATCTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10073 |
C. elegans |
T28D9(gk776) unc-4(e120) II. Show Description
T28D9. Unc. External left primer: CATTTCGGAACGTTTCCATC. External right primer: TCTGCTTCGTACTTTGCTGC. External WT amplicon: 1121 bp. Deletion size: 436 bp. Deletion left flank: TTTTTTACGTGAATCTTTTTTTTTTCAGAA. Deletion right flank: CAAGTTGTGAATTTTCGAACATCCGTCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10075 |
C. elegans |
T05A6.4(gk777) unc-4(e120) II. Show Description
T05A6.4. Unc. External left primer: GCAATCCTTCAAGTTCCCAA. External right primer: ACGACTTGCAGATGGTTGTG. External WT amplicon: 902 bp. Deletion size: 140 bp. Deletion left flank: GGGCATGTAAAAGTGTGCTTGTCTTTCATA. Deletion right flank: TACCACCATTTTTTTTTCATTTTTGGATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10077 |
C. elegans |
unc-4(e120) Y46E12BL.2(gk801gk909) II. Show Description
Y46E12BL.2. Unc. External left primer: ATCCACAATGCTCCGATCTC. External right primer: TCTGGCTTGCTTTTGTGATG. External WT amplicon: 540 bp. This strain contains two point mutations in Y46E12BL.2. The first is gk801, which is a G->A mutation at Y46E12BL coordinate 21938 (flanking sequences GTTCTTGAAGCTATACGGCTTTACACAGAA and TTACTCCAGCCGATCTGGTCACCCGTTATG). The second is gk909, which is an A->G mutation at Y46E12BL coordinate 21966 (flanking sequences AAGTTACTCCAGCCGATCTGGTCACCCGTT and TGTCGATAGTGCGATCGCCAAGTCCAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10078 |
C. elegans |
syd-1(gk802) unc-4(e120) II. Show Description
F35D2.5. Unc. External left primer: TCAACGTTGTCGCTGATCTC. External right primer: CCTCAAATTCACGGAATGCT. External WT amplicon: 543 bp. This strain carries a point mutation in F35D2.5. The mutation is gk802, which is an A->T mutation at F35D2 coordinate 23221 (flanking sequences TCGACCAACTCACTAACTCTTGAGGGCCAT and TCGACAAAATCATTTGGAGACTTGAAGATG). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10079 |
C. elegans |
unc-4(e120) mix-1(gk803) II. Show Description
M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10109 |
C. elegans |
K05F6(gk907) unc-4(e120) II. Show Description
K05F6.2. Unc. External left primer: ACAAATTCCCTTTGTCGTCG. External right primer: TGGATGAGCAGCTGGTAAGA. External WT amplicon: 200 bp. This strain carries a point mutation in K05F6.2. The mutation is gk907, which is a T->A mutation at K05F6 coordinate 21364 (flanking sequences AAATCAAAAACTCTGTTTGATGGATATCTA and ATGCCTTTAAATGATCTACTTCTTACCAGC). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC10110 |
C. elegans |
let-19(gk908) unc-4(e120) II. Show Description
K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1012 |
C. elegans |
+/mT1 II; pxl-1(ok1483)/mT1 [dpy-10(e128)] III. Show Description
C28H8.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1483 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1016 |
C. elegans |
szy-4(ok1416)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C30B5.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1416 homozygotes (sterile adult, explodes at vulva). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1038 |
C. elegans |
+/mT1 II; set-16(gk438)/mT1 [dpy-10(e128)] III. Show Description
T12D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk438 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1046 |
C. elegans |
+/mT1 II; abce-1(gk481)/mT1 [dpy-10(e128)] III. Show Description
Y39E4B.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1049 |
C. elegans |
C06A8.5(ok1515)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C06A8.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1515 homozygotes (sterile adult, often with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1082 |
C. elegans |
F55C12.1a(gk522)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F55C12.1a. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk522 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1111 |
C. elegans |
+/mT1 II; T12D8.1&T12D8.2(gk445)/mT1 [dpy-10(e128)] III. Show Description
T12D8.1, T12D8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk445 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1117 |
C. elegans |
+/mT1 II; paa-1(ok1539)/mT1 [dpy-10(e128)] III. Show Description
F48E8.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1539 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCTGCGTATCACTGTCGC. External right primer: CAGAGTTTTGTCTCGAGGGC. Internal left primer: CTCTTGTTCTCCTCATGCCC. Internal right primer: CTCGGGAACAAAAATGGAAA. Internal WT amplicon: 2209 bp. Deletion size: 621 bp. Deletion left flank: TTGGCGTTGGGTGTGGAGCGCACACGCAAC. Deletion right flank: AAGAAGAAACTCATCGAGCCAATTCTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1123 |
C. elegans |
F55C12.1(gk515)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F55C12.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk515 homozygotes (late larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1135 |
C. elegans |
R166.3(gk541)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R166.3. Homozygous marginally-viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk541 homozygotes (mostly sterile; some animals bear a few progeny, but a population may be difficult to maintain). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAGGAGTACACGCCGGATAA. External right primer: AGACCATTTTGCAGGATTGC. Internal left primer: AAGTGCTGACCGAAGAGCAT. Internal right primer: TGGGATTTGAAACGAGAACC. Internal WT amplicon: 1529 bp. Deletion size: 388 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC114 |
C. elegans |
T19E10.1a(gk44)/mIn1 [dpy-10(e128) mIs14] II. Show Description
T19E10.1a. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk44 homozygotes (sterile). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1153 |
C. elegans |
+/mT1 II; him-10(ok263)/mT1 [dpy-10(e128)] III. Show Description
R12B2.4. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok263 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1158 |
C. elegans |
T07F8.4(gk530)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T07F8.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk530 homozygotes (sterile adult, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCACTTGGCTGATTCGTCTG. External right primer: TGTGCAAATGGATCAGGTGT. Internal left primer: CCTTCAACCGTTGCTTCATT. Internal right primer: ACAGAACGATCGGGAAGTTG. Internal WT amplicon: 1857 bp. Deletion size: 974 bp. Deletion left flank: GGTTCTGCAGCAGCCGAACTTGATTCCCCT. Deletion right flank: TTACTGAGCAAACGCTTTAGTGTTAGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1162 |
C. elegans |
+/mT1 II; spe-41(ok1590)/mT1 [dpy-10(e128)] III. Show Description
K01A11.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1590 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACTATCCCCACAGAAGCC. External right primer: ATACCTACGCCCGCCTACTT. Internal left primer: GCGCGTAAACTTCTTTCCAG. Internal right primer: TCTCCACATTTTCCACCACA. Internal WT amplicon: 3007 bp. Deletion size: 1099 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1165 |
C. elegans |
let-19&sgn-1(ok331)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F07H5.2, K08F8.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok331 homozygotes (grotty sterile Dpy with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGAAAATTGGGAGTTCGGAG. External right primer: ACCACTTGTTCCTTGCCAAC. Internal left primer: GGACTGGAAACTCCAAGCAG. Internal right primer: GACTGATGAGCCGGTATGGT. Internal WT amplicon: 2637 bp. Deletion size: 1456 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1166 |
C. elegans |
+/mT1 II; brc-2(ok1629)/mT1 [dpy-10(e128)] III. Show Description
T07E3.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1629 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CATGGAAACAACAGAAGGGG. External right primer: GAGCCATTTTGAAGTTTGGC. Internal left primer: CGGCGTTTCTTCTTGTCTTC. Internal right primer: AAAATCAGGTTTTCATGGCG. Internal WT amplicon: 3006 bp. Deletion size: 809 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1175 |
C. elegans |
+/mT1 II; F37C12.13(ok1635)/mT1 [dpy-10(e128)] III. Show Description
F37C12.13. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1635 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1203 |
C. elegans |
+/mT1 II; apc-2(ok1657)/mT1 [dpy-10(e128)] III. Show Description
K06H7.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1657 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACGCAAAATACGCAAAAA. External right primer: GGAAGTGCTGATTTGGCAGT. Internal left primer: ATGACGACAGTTCTGCAACG. Internal right primer: GGCTGACGATCTCTTGGAAA. Internal WT amplicon: 3306 bp. Deletion size: 650 bp. Deletion left flank: CCTAAATTATATATAACATTTTCAGAAAAA. Deletion right flank: GACCTGACACTGTACAACAAATTATCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1224 |
C. elegans |
polg-1(ok1548)/mT1 II; +/mT1 [dpy-10(e128)] II. Show Description
Y57A10A.15. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1548 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Outer Left Sequence: ACCGTAGCCCTTTCCTCATC. Outer Right Sequence: CGCATTTCCCATCTGTCTTT. Inner Left Sequence: ACCTCTTCGTTTTGGGGATT. Inner Right Sequence: CCATCCGGCCTATTTAATCA. Inner Primer WT PCR Product: 3241. Deletion size: 2149 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1242 |
C. elegans |
+/mT1 II; cup-5(ok1698)/mT1 [dpy-10(e128)] III. Show Description
R13A5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAGCCCGAAATTTTTGTAA. External right primer: CCGTAATATGTGTTGCAGCG. Internal left primer: CGTGTCTCTAGCTTCCCTGC. Internal right primer: ATCTACGTGCATTCGCACTG. Internal WT amplicon: 2867 bp. Deletion size: 1546 bp. Deletion left flank: TGCTTCTTCAAATGCTTCTCGAAGGCCAAC. Deletion right flank: ATTGTGGTCAACGATGCGCTTATTATCATT. Insertion Sequence: GTGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1249 |
C. elegans |
+/mT1 II; ula-1(ok1700)/mT1 [dpy-10(e128)] III. Show Description
C26E6.8. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1700 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTTTCCGGGGATATCTAA. External right primer: CGTACTGCCTGCATGAGAAA. Internal left primer: ATGTCATGCCACAAGGAACA. Internal right primer: CATTCTTGTGAAACTCGCCA. Internal WT amplicon: 2184 bp. Deletion size: 930 bp. Deletion left flank: GAATGTTGCCGACTCCTGAGTATGTCCATC. Deletion right flank: GAACGTCGGAAACTCATAAGAATCGCCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1261 |
C. elegans |
+/mT1 II; C36E8.1(ok1714)/mT1 [dpy-10(e128)] III. Show Description
C36E8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1714 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGAGGATCCACCCATCATC. External right primer: GAAGCTTGAAGAAGAGGCGA. Internal left primer: TGGAGTCATGAACTTGCTGC. Internal right primer: GAAACTTTCGAGCAATGGGA. Internal WT amplicon: 3294 bp. Deletion size: 833 bp. Deletion left flank: ACATTCTAGAAATGTGTCAAAAAGCTTCTC. Deletion right flank: TTTCAAAATGCTCATTTTGAACTTTTTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1274 |
C. elegans |
H20J04.6(ok1739)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
H20J04.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1739 homozygotes (slow-growing, sickly, mostly sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CCCGGAGCATGAAATTCTTA. External right primer: AATGGAGCTCGAAAATGTGG. Internal left primer: TCCAACGCACAATTGAAAAA. Internal right primer: TCCAGCAAAATATGGTGCAA. Internal WT amplicon: 2146 bp. Deletion size: 853 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1275 |
C. elegans |
C47G2.5(ok1740)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C47G2.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1740 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GTGGAGTGTGAAGGCCACTT. External right primer: AAAGAACCGCAAAATCGAGA. Internal left primer: AATGCACACTCTGCGTTTTG. Internal right primer: TTCTGGTTGAAAATGAGGGG. Internal WT amplicon: 3279 bp. Deletion size: 1176 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1300 |
C. elegans |
F28C6.1(gk582)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F28C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk582 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATGATAAGACGTCCTTGCCG. External right primer: TGCCTCTGCATTGTTCTCAC. Internal left primer: TGTTTGCACTGTTCGACGTT. Internal right primer: GGCGGATTGATTCATATGCT. Internal WT amplicon: 2222 bp. Deletion size: 1146 bp. Deletion left flank: GCGGTTTTTAAAATAACGTGAATATTGCTT. Deletion right flank: GACAAACACTGAGCGAGAAAACGAATCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1330 |
C. elegans |
abu-14(ok1789)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK1067.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1789 homozygotes (variable arrest, larval through sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAACAGAAGTTGTCGCA. External right primer: GTCAACAAACCAAATGCGTG. Internal left primer: AGAATTCAGGGAAGGGGATG. Internal right primer: CTCCGGTTTCCGAGTATGAA. Internal WT amplicon: 2113 bp. Deletion size: 292 bp. Deletion left flank: AAAAGTAGTATTTAAAAAAGAAATTTACCT. Deletion right flank: GCGTTCGAAACAACTCCTTGAATCGGAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1333 |
C. elegans |
evl-20&cut-3(ok1819)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F22B5.1, F22B5.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1819 homozygotes (sterile adult, often with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATGAACGCTTTTGCAGAC. External right primer: TGAGAACGGTTGTGCTCTTG. Internal left primer: TACCAATTGGACGAGGAAGC. Internal right primer: TTCTTGATGTCCGTGCTGAG. Internal WT amplicon: 2108 bp. Deletion size: 757 bp. Deletion left flank: TGCTTTAATTTGGGTGGTAGATTCGTCAGA. Deletion right flank: AACGGTAAGACCAAGGAAGACAGTGACAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1336 |
C. elegans |
vha-6(ok1825)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
VW02B12L.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1825 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGAATGGCTCGAACT. External right primer: TCATCCATCATTCCAGAGCA. Internal left primer: GGAACTCGACCCAATGAAGA. Internal right primer: GGTGGCGGTCTGATATTGAT. Internal WT amplicon: 3301 bp. Deletion size: 982 bp. Deletion left flank: GGCTTGACGAGAAGCATAACTGGAACAGAT. Deletion right flank: GGAGCTGGATTAACTTCTCGATAGTTGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1345 |
C. elegans |
mtch-1(ok1800)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F43E2.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1800 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCGTATCAAGTCGCTCGTT. External right primer: AAACCTCAGCGGTCAGAAGA. Internal left primer: ATTGGATGGATCATCGGGTA. Internal right primer: GCATCTTCCTCGACTTGTCC. Internal WT amplicon: 2135 bp. Deletion size: 1182 bp. Deletion left flank: CTCGAAAAATACATTATAGCGAAGATTGGA. Deletion right flank: ATTTCTCCTGTAAAACTGAATTTCAAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1368 |
C. elegans |
klf-3(gk612)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F54H5.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk612 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTGCGCAATATCCAGAGA. External right primer: TCATCATTGACTTCCCACCA. Internal left primer: CCGAAAGAGAGTGAAGACGG. Internal right primer: TAAGCTGATCGTTGACCGTG. Internal WT amplicon: 1778 bp. Deletion size: 571 bp. Deletion left flank: TTCCTCTCCCGCAATTTGAATTTTTTCTCT. Deletion right flank: CCATCAAAATGGAGATTCCCATGCATCCGT. klf-3 was formerly known as mua-1. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1396 |
C. elegans |
+/mT1 II; klp-6(ok1869)/mT1 [dpy-10(e128)] III. Show Description
R144.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1869 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCCAGATGAGGAAACAACA. External right primer: CTCAGGTGACACCAAAACGA. Internal left primer: TCGAAGATCTTGGCAGAGGT. Internal right primer: ACATACCCCAACTCAGTGGC. Internal WT amplicon: 3130 bp. Deletion size: 1991 bp. Deletion left flank: ATCGAGAAGGCTGTGTATGTGTGTCAACTT. Deletion right flank: AACAGAACGAGCTCTTCGTGAACTCCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1397 |
C. elegans |
+/mT1 II; F25F2.1(ok1876)/mT1 [dpy-10(e128)] III. Show Description
F25F2.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1876 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGAGTATCGCGCATCATA. External right primer: TCCATTGCATCCAAACGTAA. Internal left primer: CCGAATGGCGAGAGATGTAT. Internal right primer: TTTGTTGGCAATGAGTGCAT. Internal WT amplicon: 2539 bp. Deletion size: 1864 bp. Deletion left flank: GACGGATCATGTGGTCATTGCTGAGAAGTT. Deletion right flank: GAATCTGCAGAAGCAGAAGCAACTGCTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|