Search Strains

Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and paralysed DpyUnc. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and DpyUnc. Maintain by picking WT. [2/97: This strain also throws Dpys. RK Herman put a new mnC1 dpy-10 unc-52 chromosome into the strains, and it still continues to throw Dpys. It seems that the mnC1 dpy-10 unc-52 chromosome is correct. It's possible that the mnDf97 chromosome is broken.]

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are Dpy and segregate Dpy, dead eggs and paralysed DpyUnc. Maintain by picking Dpy.

Hets are WT and segregate WT, paralysed DpyUnc and Unc-4 lethals that arrest at L2. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. [12/93 **mnC1 appears to have broken down**]

Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation.

Heterozygotes are Unc (n754 is dominant Unc and recessive lethal). Hets throw Dpys which give only sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 1% maternal effect embryonic lethality.

Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.

Crispr/Cas9-engineered indel in the 5’ region of rpa-1. Larval-lethal mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP iow117 homozygotes (larval lethal). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. iow117 was generated in mre-11::GFP background and outcrossed to N2. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.

Heterozygotes are WT and segregate WT, Dpy Uncs, and animals with muscle attachment defects and ventral cord displacement and detachment. Not well balanced. klf-3 was formerly known as mua-1.

ncIs3 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. Heterozygotes are WT and segregate WT, DpyUncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development.

ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.

Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.

Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.

Heterozygotes are WT and segregate WT, Unc L1 lethals and dead eggs (homozygous zen-4(w35)).

Heterozygotes are WT and segregate WT, Stu and DpyUncs. n3070 is a strong loss-of-function or null allele. Molecular lesion: P to S at position 24 as well as an amber mutation terminating translation after amino acid 52. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.

Heterozygotes are WT and segregate WT, Stu and DpyUncs. n3066 is a strong loss-of-function or null allele. Molecular lesion: ochre mutation terminating translation at amino acid 538. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.

Heterozygotes are WT and segregate WT, Stu and DpyUncs. Molecular lesion: amber mutation terminating translation at amino acid 159. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.

Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(n3064).

Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1.

Heterozygotes are WT and segregate WT, Stu and DpyUncs. e1457 is a strong loss-of-function or null allele. Molecular lesion: G to E at position 40. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.

Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he24).

he25 is temperature sensitive. At 25C: Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. At 15C: Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes) and cdk-1 homozygotes which are slightly smaller than WT, complete nearly all cell divisions, are sterile and have less germ cells than N2 (sperm are present but no oocytes). Previously called ncc-1(he25).

Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he26).

Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he5).

Unc. ts Dpy.

Unc. Temperature sensitive. Maintain at 15C.

Temperature sensitive. Dpy.

Long lived (1.4X CB120). Low brood size. Unc. Temperature sensitive sperm defect. Maintain at 15C.

uIs25 [mec-18::GFP + dpy-20(+)].

yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc.

Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Heatshock induces expression of lacI::GFP in the soma, which binds to integrated lacO arrays. lacI::GFP expression is silenced in the germline. Derived by out-crossing PS2442 to remove e1282. Reference: Severson AF & Meyer BJ. Elife. 2014 Aug 29;3:e03467.