More Fields
Strain Species Genotype
RB1532 C. elegans K05F6.11(ok1837) II. Show Description
K05F6.11. Homozygous. Outer Left Sequence: TGGCTAGCCCTACCTTTCCT. Outer Right Sequence: CCAAGGGTGTCATCGAAAGT. Inner Left Sequence: TTCAAAGCCCCTCGTTTCTA. Inner Right Sequence: TCTTGCAAAGGCAAGATTCA. Inner Primer PCR Length: 3109 bp. Deletion Size: 1437 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2054 C. elegans fbxb-44(ok2717) II. Show Description
K05F6.5. Homozygous. Outer Left Sequence: TGGCTAGCCCTACCTTTCCT. Outer Right Sequence: GCGCCGATATGTGTGTATGT. Inner Left Sequence: TCAACATGGGAGTTATGGAGC. Inner Right Sequence: GCGTGAAACGAGTAGCTTGG. Inner Primer PCR Length: 1230 bp. Deletion Size: 408 bp. Deletion left flank: TGAAAAGAATGGAGCTGCTTACAATCCAAA. Deletion right flank: GCTTCCAAAAATTACCTGATCGCACTACGT. Insertion Sequence: CATTGTTTTGGAAGGAATTCATCACGAGTTTGCACCAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10109 C. elegans K05F6(gk907) unc-4(e120) II. Show Description
K05F6.2. Unc. External left primer: ACAAATTCCCTTTGTCGTCG. External right primer: TGGATGAGCAGCTGGTAAGA. External WT amplicon: 200 bp. This strain carries a point mutation in K05F6.2. The mutation is gk907, which is a T->A mutation at K05F6 coordinate 21364 (flanking sequences AAATCAAAAACTCTGTTTGATGGATATCTA and ATGCCTTTAAATGATCTACTTCTTACCAGC). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807