Search Strains

Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncLet larvae are abnormal. Pick WT to maintain.

umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.

Temperature sensitive. Maintain at 15C.

syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.

lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. PQR migration defects: PQR in the head in the normal position of AQR. lq42 is a premature stop codon in egl-20. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Josephson M, et al. PLos One. 2016 Feb 10;11(2):e0148658. doi: 10.1371/journal.pone.0148658. PMID: 26863303.

lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. AQR and PQR migration defects. lq83 is a hypomorphic allele of cdh-4. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Sundararajan L. et al. Dev Biol. 2014 Aug 15;392(2):141-52. doi: 10.1016/j.ydbio.2014.06.009. PMID: 24954154.

lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. AQR and PQR migration defects. lq97 is a hypomorphic allele of cdh-4. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Sundararajan L. et al. Dev Biol. 2014 Aug 15;392(2):141-52. doi: 10.1016/j.ydbio.2014.06.009. PMID: 24954154.

lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. AQR and PQR migration defects. lq132 is a hypomorphic allele of nfm-1. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Sundararajan L. et al. Dev Biol. 2014 Aug 15;392(2):141-52. doi: 10.1016/j.ydbio.2014.06.009. PMID: 24954154.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. lqIs80 [SCMp::GFP::caax] IV. Rollers. GFP expression in seam cells. Red fluorescence in vulvae. YFP cannot be detected.

qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. Utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. RNAi sensitized strain with utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

cdIs80 [pcc1::PLCd::GFP + rol-6(su1006)]. Rollers.

ynIs80 [flp-21p::GFP].

syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. GFP expression in developing vulval cells, VCs and uterine pi lineage cells. Received new stock 9/2003. Do not distribute this strain; other labs should request it from the CGC. Received new strain from Bhagwati Gupta on April 7, 2008.

Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs80 [eor-1::TGF(9G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

GFP knockin at N-terminus of Y75B8A.6 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

wbmIs80 [rab-3p::3XFLAG::raga-1::SL2::wrmScarlet::rab-3 3'UTR] *wbmIs68. Neuron-specific RAGA-1 and wrmScarlet expression driven by the rab-3 promoter. Derived by CRISPR-mediated insertion of raga-1 downstream of tissue-specific eft-3 promoter of wbmIs68 insertion in parental strain WBM1144. wbmIs68 [rab-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs66] (IV:5015000). Reference: Zhang Y, et al. Elife. 2019 Aug 14;8:e49158. doi: 10.7554/eLife.49158. PMID: 31411562.

qaIs8001 [fhod-1::GFP + unc-119(+)]. Integrated functional translational FHOD-1::GFP fusion. Superficially wild-type. Reference: Mi-Mi L, et al. J Cell Biol. 2012 Jul 9;198(1):87-102. doi: 10.1083/jcb.201202053.

RollerUnc. At 25C e1948 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. e1948 recessively suppresses vulval lineage defects and proximal mitosis. sc8 previously called rol-4(sc8). See also WBPaper00002448. Do not distribute this strain; other labs should request it from the CGC.

vxSi808 [rab-3p::APP::mCherry::unc-54 3'UTR] X. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Single-copy insertion of human APP transgene tagged with mCherry expressed throughout the nervous system, visible along ventral nerve cord, head, tail, and other neurons. GFP expression in all serotonergic neurons. References: Yi B, et al. 2017 J Neurochem 140(4): 561-575. PMID: 27926996. Mondal et al. 2018 ACS Chem Neurosci. DOI: 10.1021/acschemneuro.7b00428 PMID: 29426225

vwIs346 [pie-1p::LAP::CDC-48.2 + unc-119(+)].

Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.

otIs809 [glr-7::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

wgIs800 [gei-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs801 [B0336.3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs802 [scrt-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs808 [ceh-58::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44.

wgIs809 [ets-5::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of cpn-4 (F49D11.8). Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCAAGCAAGTTCAATGATGTTGAAGCTGGATACT; right flanking sequence: TGTTGGAATGGATTCGGgtaagatttgggtagatt; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55F3BL.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGACGACGGATTCACCCTGGTCACTGGTAGAAA Right flanking sequence: AGCCGGAAAACAGTCGGCGAAATTTgtcagttttc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGTCACTGGTAGAAAAGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syIs503 [15xUAS::Chrimson::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. Reference: Cao M, et al. Application of the red-shifted channel rhodopsin Chrimson for the Caenorhabditis elegans cGAL bipartite system. MicroPubl Biol. 2018 Aug 22;2018:10.17912/2JGW-FJ52. doi: 10.17912/2JGW-FJ52. PMID: 32550400.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGC Right flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of R173.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCGAATTGAGGGTCAACTCTGGAGCAATCCG Right flanking sequence: taagtacatgattttttattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTCTTACCAGTCGCTCTCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of cest-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGGAGACCTTCGATATCGAAAACCCCGTCCACCG Right flanking sequence: AAATCATGGGAAGGAGTTTTGGTAACAAATGAATA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ACTCCTTCCCATGATTTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F13H6.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGGGTACCTCGGGATCCCGTATGCGAAACCACCA Right flanking sequence: GTCGGCGAACTTCGATTTAAGAAGCCAGTAACCGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AATCGAAGTTCGCCGACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syEx1649 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.

syIs802[Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background.

syIs803 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background.

syIs804 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background.

syIs807 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background.

syIs824 [15xUAS::Chrimson::tdTomato::let-858 3'UTR + myo-2p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. [NOTE: due to an error in the information submitted to the CGC, this strain was previously described as carrying the array syIs803 with a ttx-3::RFP co-injection marker. The correct name for the array is syIs824 and it carries the myo-2p::GFP marker.]

syIs807 [pps-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.