Search Strains

qIs26 [lag-2::GFP + rol-6(su1006)]. ok467 deletion balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and npp-10 homozygotes (Emb or early Larval lethal). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain.

qIs26 [lag-2::GFP + rol-6(su1006)]. Throws heterozygous Rollers and Unc eT1 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. It was an integration of qEx233. Do not distribute this strain; other labs should request it directly from the CGC.

qIs26 [lag-2::GFP + rol-6(su1006)]. Rollers. Homozygous sterile deletion allele tm1868 balanced by qC1 with rol and GFP markers. Segregates GFP + Roller heterozygotes, and non-rol non-GFP tm1868 homozygotes (sick, sterile, unc). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Pick Rol GFP+ and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygous animals show roller phenotype and GFP signal at the distal tip cells. Segregates roller GFP(+) heterozygotes, wild-type moving GFP(-) him-18(tm2181) homozygotes. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygous animals are dead. P0 him-18(tm2181) homozygous animals show 80% embryonic lethality and 12% high incidence of male at F1. Pick roller GFP(+) worms to maintain. Reference: Saito TT, et al. (2009) PLoS Genet 5:e1000735.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm498) is homozygous sterile.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm499) is homozygous sterile.

qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. qa6200 has maternal effect sterility and maternal effect embryonic lethality.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. tm1227 has maternal effect sterility and maternal effect embryonic lethality.

qIs26 [lag-2::GFP + rol-6(su1006)]. or1948 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1948 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.

qIs26 [lag-2::GFP + rol-6(su1006)]. or1951 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1951 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.

qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

Heterozygous animals Roll and have GFP(+) distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes which are sterile and vulvaless. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. q1190 is a deletion in mpk-1 that removes 2221bp between axons 2-7 (based on mpk-1b annotation). Sequence is shared between mpk-1a and mpk-1b. The deletion is in frame and leaves 27bp of coding sequence.Reference: Robinson-Thiewes S, et al. Cell Rep. 2021 May 25;35(8):109162. doi: 10.1016/j.celrep.2021.109162.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(bn129) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(bn129) homozygotes are short-lived on OP50. bn129 is a deletion removing 748 bp from exon 11 of SET-2L and from exon 3 of SET-2S resulting in a frameshift after 885 aa of SET-2L and after 117 aa of SET-2S with a premature stop four codons later. References: Robert VJ, et al. Front Cell Dev Biol. Dec 2020 Sep 22:8:561791. doi: 10.3389/fcell.2020.561791. PMID: 33072747. Xiao Y, et al. Proc Natl Acad Sci USA. 2011 May 17;108(20):8305-10. doi: 10.1073/pnas.1019290108. PMID: 21527717.

Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(syb2085) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(syb2085) mutant animals that express a catalytically inactive form of SET-2, the C. elegans SET1 homolog. set-2(syb2085) homozygotes are not long-lived on OP50. Reference: Caron M, et al. Life Sci Alliance. Dec 2021, 5 (3) e202101140; DOI: 10.26508/lsa.202101140. PMID: 34893559.

qIs26 [lag-2::GFP + rol-6(su1006)]. Homozygotes are unhealthy. Deletion of 1671 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) unhealthy animals (ve661 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aaaaatccgctagaaaccgtctaaaaacct ; Right flanking sequence: AGGCTTCACGTGCTGAAAGATTCGGAATTA. sgRNA #1: atcaatagcgtaggctttac; sgRNA #2: ACTAACATCAAATGACGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval lethal. Deletion of 1104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) early larval lethal (ve938 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: ATCCATGAGCTCGAGTTGAAGTTGATGCGT; Right flanking sequence: TGGAATTTACAGAATTTCAATGGAAATAAC. let-767 sgRNA A: GATGTATCCGGTGGTGTCTG; let-767nsgRNA B: CACTGGCAAGCCATGTTACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Sterile. Deletion of 651 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) grotty adults with vulval blip (ve941 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: GCGTCACACGCTCCAGGCAGCTCTCTGTCT; Right flanking sequence: GAATTTTTGAAGCGTTTCAATTAAttttct. arx-6 sgRNA A: TGAGCAATTCAGTTCGCAGG; arx-6 sgRNA B: TTCAGCAGAAACACGGGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Emb. Deletion of 22058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), dead embryos (ve978 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aggtagaaaaaatgtagactagccccccct; Right flanking sequence: tcgttttccaaattaatcagaaattagcat. let-805 sgRNA #1: tgagtcagcagaggccgggg; let-805 sgRNA B: attacGTTGGGTTGCAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 2015 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve993 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Note: this strain exhibits ectopic body wall GFP expression. Left flanking Sequence: aaggctcgacatgtaattacacacatacCT; Right flanking sequence: AGGGGAACATCAAGTCCAGGGAATGCATCT. rars-1 crRNA A: GTTATTGAAAATAAGGAAGG; rars-1 crRNA B: TTGGAGTTTCAGCGAGGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III. Mel. Deletion of 2623 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) adults that give progeny that die early (ve1002 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAAGTTAAATATTGATGTTGAAGTTTGCCT; Right flanking sequence: ATTTTTAATAATAATTCTGAAATTTATTTT. madf-11 crRNA A: GTTCCCATTGAAAAATCACC; madf-11 crRNA B: TTCCAATGAGCGACCGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 1643 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve1004 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: TGTAACTCATCTCAAAGCGTGAGAGTTCCT; Right flanking sequence: ATCATAGAAGAATCGTCTTTTGAGAAGATC. gars-1 crRNA A: AGTTATGGATGCCGTTAAGG; gars-1 crRNA B: CAATCATTTGCTATCTATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 1120 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve1033 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAACCTGAGTTTATTTACGCAAATTCGCCA; Right flanking sequence: CGGAGTTGTGAGAGAATCTCGAACAAAAAC. mrps-34 crRNA A: AGAAACGAACCAAACATCAG; mrps-34 crRNA B: CAGCAGAATAACATACGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.