Search Strains

ldIs3 [gcs-1p::GFP + rol-6(su1006)]. Rollers. Reference: Wang J, et al. PLoS Genet. 2010 Aug 5;6(8). pii: e1001048.

ldEx1050 [pcst-1p::pcst-1::GFP +rol-6(su1006)]. Maintain by picking Rollers. Reference: Lehtinen MK, et al. Cell. 2006 Jun 2;125(5):987-1001.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs58 [gcy-32::CFP] V. Reference: Josephson MP, et al. PLoS One. 2016 Feb 10;11(2):e0148658.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. lqIs80 [SCMp::GFP::caax] IV. Rollers. GFP expression in seam cells. Red fluorescence in vulvae. YFP cannot be detected.

geIs3 [sir-2.1(+) + rol-6(su1006)]. Rollers. This strain replaces LG100. Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.

geIs7 [skn-1b::GFP + rol-6(su1006)]. Rollers. Reference: Nature (2007) 447(7144):545-9.

geEx1 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Pick Rolling GFP+ and check for correct segregation of progeny to maintain. skn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Reference: Nature (2007) 447(7144):545-9.

geIs8 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.

geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.

geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.

geIs10 [ges-1p(long)::skn-1c::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.

geIs10 [ges-1p(long)::skn-1c::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.

geIs3 [sir-2.1(+) + rol-6(su1006)]. Rollers. This strain contains the transgene from LG100 crossed away from a linked dyf mutaion. Reference: Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.

geIs101 [rol-6(su1006)]. Rollers. Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.

xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.

qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

adIs2122 [lgg-1::GFP + rol-6(su1006)]. Rollers. Maintain at 15C. ~30% animals form dauers at 20C. Not all animals will roll, but all should be GFP+. Reference: Egan DF, et al. Science. 2011 Jan 28;331(6016):456-61.

sqEx4 [atg-18p::atg-18::GFP + rol-6(su1006)]. Pick GFP+ Rollers to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

sqEx9 [argk-1p::argk-1::mCherry + rol-6(su1006)]. Pick mCherry+ Rollers to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

stEx30 [myo-3p::GFP::myo-3 + rol-6(su1006)]. Rollers. Pick GFP+ Rollers to maintain. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

sqIs11 [lgg-1p::mCherry::GFP::lgg-1 + rol-6]. Rollers. Tandem-tagged autophagy reporter strain.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

sqIs19 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Rollers. Slightly longer lived at 20C. hlh-30::GFP expression should be visible at relatively low magnification. [NOTE: the array does not segregate 100% in original stock; pick GFP+ and check for correct segregation to maintain the array. New stock recevied at CGC June, 2016.] Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.

sqIs17 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Rollers. Slightly longer lived at 20C. hlh-30::GFP expression should be visible at relatively low magnification. Derived from JIN1679. Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.

sqIs25 [atg-18p::atg-18::GFP + rol-6(su1006)]. GFP+ Rollers. Derived by integration of sqEx4 in MAH145. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

sqEx27 [sur-5p::argk-1::GFP + rol-6(su1006)]. Pick GFP+ Rollers to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

adIs2122 [lgg-1::GFP + rol-6(su1006)]. Rollers. Reference: Egan DF, et al. Science. 2011 Jan 28;331(6016):456-61.

sqIs32 [sur-5p::argk-1::GFP + rol-6(su1006)]. GFP+ Rollers. Derived by integration of sqEx27 in MAH264. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

sqEx67 [rgef-1p::mCherry::GFP::lgg-1 + rol-6]. Rollers. Pick Rollers to maintain.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. mgEx779 [lipl-4p::lipl-4::SL2::GFP + myo-2p::mCherry]. Pick RFP+ Rollers to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

sqEx82 [argk-1p::GFP + rol-6(su1006)]. Pick Rollers with GFP expression in nerve ring and posterior intestine to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Approx. 50% sterility at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

sqEx146 [sqst-1p::sqst-1 + rol-6]. Pick Rollers to maintain array. Strain over-expresses non-tagged p62/SQST-1, a key autophagy substrate. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648.

muIs84 [sod-3p::GFP + rol-6(su1006)]. Weak rollers. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. ot406 has a dopaminergic phenotype. mu290 is Egl and has a PDE dopaminergic phenotype.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. ot406 has a dopaminergic phenotype.

otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. Rollers.

otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. norEx42 [ast-1 Cosmid + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. norEx42 [ast-1(+)(cosmid) + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. norEx42 [ast-1(+)(cosmid) + ttx-3::GFP + dat-1::mCherry]. Rollers. ot406 has a dopaminergic phenotype. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP at C terminus + odr-1::RFP(su1006)]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(mu290); ceh-40(gk159) double mutants is rescued by muEx261. ot406 has a dopaminergic phenotype.