Search Strains

Y71H2AM.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1854 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GCACCATCTCCGGGATATAA. External right primer: CCGTAAATTGACACAACCGA. Internal left primer: CGCCAAAACTCATCGAATCT. Internal right primer: CTCTTGAGCTCAGGCTTCGT. Internal WT amplicon: 2882 bp. Deletion size: 1642 bp. Deletion left flank: TCATACGTCGAGCAAGGAGTTGCTCATTGT. Deletion right flank: CAATTTTTTCACTTATTTTTATCTGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92C3B.1, F58B6.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1890 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCCCTCACCTCGACTT. External right primer: AAAAATTGGAAAAATCCGGG. Internal left primer: CGAAGGGAAAATGCAGGATA. Internal right primer: TAAAAATCGGCAGAAATCGG. Internal WT amplicon: 2138 bp. Deletion size: 898 bp. Deletion left flank: AGGATAATTTTTTTTTTGTTGGGAAATTTA. Deletion right flank: TACGGGCTTCGCAGAGCGATTTATCGATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71H2AM.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2025 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGTCATGTTTTTCCGGTGA. External right primer: TCTCGCTTCACGTTTTTGTG. Internal left primer: TTTTATTCGCATTTCCTCCG. Internal right primer: TCGGCTTTCTCCTCATGTTT. Internal WT amplicon: 2726 bp. Deletion size: 1372 bp. Deletion left flank: CACAAGTGGCTCACCGACTAAAAAATCGAG. Deletion right flank: ACTATTCAATGTCTTCCAGATGATGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54C1.5. External left primer: CACGTGCACCGAATCAATAC. External right primer: TATTGGTCGCGTTCAAACAA. Internal left primer: CGGGTTTCTTTCGTGTTGAT. Internal right primer: ACTCGAGGGAAAGGAAGAGG. Internal WT amplicon: 1849 bp. Deletion size: 1342 bp. Deletion left flank: GCATCGCATTCATTTTGACAAGCTTACACA. Deletion right flank: ATAACTTCAATTGACATATTTTTAATTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2143 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1196 bp. Deletion left flank: TCTCCAAACTCACTTATTGGAAAAAGCGTC. Deletion right flank: ATAAGTGAGATATCGGCCAAGCAATAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H06I04.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2277 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGACAACTCCTTGCCTCACC. External right primer: ATTCCCCGCCATTTATTACC. Internal left primer: CAAACAATCCCAAATTCTCG. Internal right primer: AGCTACAGTAACCCGCGAAA. Internal WT amplicon: 3080 bp. Deletion size: 1808 bp. Deletion left flank: AAAAAAAATTTCTAAATTTATTCCCAATTT. Deletion right flank: TCAAAAAATCAGGGGTTCGTTGTGAAAAAT. Insertion Sequence: TCTTCTAAATTTATTCCCAATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54F10AM.10. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2313 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGGCGACTTTTCAC. External right primer: AGGGGGAACTGTCGGTTAGT. Internal left primer: TACAAATCCCCGTCCCAATA. Internal right primer: AGAAGTCGAGGTGGCAGGTA. Internal WT amplicon: 3304 bp. Deletion size: 2261 bp. Deletion left flank: GCGATAATTTGTTGTTTTTACTGAAAATTT. Deletion right flank: TCGAGGGTGGCTACTGTATTCTCGCGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C1.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2420 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTGCTCCTGCTTTGCAT. External right primer: CCGAGTTATCGTGACCCACT. Internal left primer: AGCAGTGGGAGTGCAAGACT. Internal right primer: ACGTCGAATGATTTTGGGAG. Internal WT amplicon: 3175 bp. Deletion size: 2459 bp. Deletion left flank: TGAGGATCGTAACAAGGAGCTTGTGATTGA. Deletion right flank: ACCACCAGACTCAATTGTGATGGAATCTCA. Insertion Sequence: TATTGAAAACTTTTCAGGGTGATATTCCCAGTCTTCTTCAACAAGCTTCACCTCCAGGA GGAGTTAAATCTCCATCAGCTGTAGTATTTCCGCCTGTTTCCGCAGCTGTCGCTGCAAT CACTGAAATTTCTCCACAAAGTAGCTACTCATCAATTGTGCCAAAAGTGGAAACCGATC AAATCTCCCAACAACTATTTAAATGTTAGTTTTTTATGCGATACAATTATTGCATCAAA CTAATTTTCTCATGTTTCCAGCTCTTCCTTTGTGGTCATTCCAACAAACTCCTGGATTA CCTATCGGAATGGATCTATCACAACTTGTTTTCCAACAATCCTCTCCCGACAAAACAGT TTCACCTGTGAAATCAGAAGTTGTAGAAGAAACGAAACCAATCGCTTCTTCACAATTAA CACTTCACAGCTTCTCCGCATATGTCAAATGTAATAAGACAAGTTTAAGGACAGAACTC GTGAAGATTGAGAATACACTGGAAAAAGATGATATTGACATTTCTGTATTTTACGAAAA ATATCCGAAATTACTTCGAGAATTGTTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2213 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1051 bp. Deletion left flank: TGGGATGAATTTATGTGCAACATGCTCGTA. Deletion right flank: ACATTTTTATCATTATAACGAATATTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2476 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTTTCGCCGTTTGATGTC. External right primer: CCGAAAATTAGCCGATTTGA. Internal left primer: TGATAAATGGTGTGCTCCGA. Internal right primer: GATTTATCCGTCAGCCGAAA. Internal WT amplicon: 2623 bp. Deletion size: 1324 bp. Deletion left flank: CTAAGGCCATAAAAATCAACAAAATCTAAA. Deletion right flank: TATTTAGCAGACCAAAGTTGGGTATCCAAT. Insertion Sequence: GAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1068) in Y53F4B.4 and Y53F4B.42, detectable by PCR using the following primers. External left primer: GGCAAAATTGTACGCATCCT. External right primer: CTTGTTTCGCTCGATTCACA. Internal left primer: TCTCGTTAGGTATTTGCGGC. Internal right primer: CGCAACTGCGTTAAATCGTA. Internal WT amplicon: 2605 bp. Deletion size: 557 bp. Deletion left flank: AATAGAAAATGCATTTTAAAATGCGAAAAA. Deletion right flank: CCCGATTTTTGACCGATGACACCAAAGTTT. Validation: gk1068 passed by CGH. Other deletions (gk3262, gk3263) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y82E9BR.16. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2740 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCTGGGGATTTTAGCG. External right primer: TATCACCACATTTCCCGTCA. Internal left primer: AATTTGAAAATTTTTGAGGTTTCAT. Internal right primer: TTTCGCGGAAATATTGAACTTT. Internal WT amplicon: 3097 bp. Deletion size: 1978 bp. Deletion left flank: TTTTTTCAAATCGTTGCTAAATTTGAATTT. Deletion right flank: GGGCTTTTTCAGCAATTTCCGGGTAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42C1.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2912 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCGCTCGGAGAGTTGTACC. External right primer: ACGTGCTACCGTAATCCGAC. Internal left primer: TCGCACTTACCGTATCCACA. Internal right primer: TGATCCTGAAAAGGGGACAG. Internal WT amplicon: 1205 bp. Deletion size: 429 bp. Deletion left flank: TTTCGAAAGAGAATCCATAGATAGTCGATC. Deletion right flank: TCCTTTAAGAATTGGTGTTGAAAAGACTAG. Insertion Sequence: TCAACAAGCTATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22C1.7. External left primer: TGGAATGTGTGGTTGAAGGA. External right primer: GGTGATCCCTCTGGCTGTAA. Internal left primer: TTGTGAATTGATTGGTGTTTGA. Internal right primer: GGCCTTTCTGGTAGAGGAGG. Internal WT amplicon: 1144 bp. Deletion size: 637 bp. Deletion left flank: TTCGGCATCACATGATTGTGATACGCTTTT. Deletion right flank: AATTTCAAAAATTTCCCTCATAATTTCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38F1A.10. Apparent homozygous lethal deletion chromosome balanced by recombination suppressor marked with dpy-10 and unc-52. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and ok2553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACAGAAATCGACAGCAGG. External right primer: ACGGGAACCCCCATATACTC. Internal left primer: AAGCGGTAAATGACGGAATG. Internal right primer: TGTGTCTGTGTGTCTTCGCA. Internal WT amplicon: 3342 bp. Deletion size: approximately 2000 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92C3B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1- and lethal-marked recombination suppressor. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and gk1036 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGAAAGATGGATTTTTCGCA. External right primer: AAAATTCGTGAAAATTGCCG. Internal left primer: ATTTCTCGCTTCCACGACTG. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1125 bp. Deletion size: 606 bp. Deletion left flank: ATAGATTTTTGGCAAAGAAAATGAAAATTT. Deletion right flank: GGCGTTCAATATCTTCAAGTTTCATGCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22C1.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3195 homozygotes (Dpy sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTTGCCAAGCAGGTTAAAA. External right primer: CGACACATTTTGTGCCACTC. Internal left primer: TATTTGCTCGGAGATTTCGC. Internal right primer: ATTCGAGCAGGTTCCGTAGA. Internal WT amplicon: 1279 bp. Deletion size: 809 bp. Deletion left flank: TTTTCAGCAAAGTTCGAACGAAAAAACTCT. Deletion right flank: TTGATAGCAAAATGCGAAAAAACAGTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06C1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3308 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAGCTGGGACTTCGTTG. External right primer: TTTTGGCTGCTCGCTTTTAT. Internal left primer: GGGTTTCTAGCGATTTTTCCA. Internal right primer: ACGATTTTCGTGCCAATTTC. Internal WT amplicon: 1322 bp. Deletion size: 556 bp. Deletion left flank: TTGGCCTGCTCGGGGAGCACAAGAGCTGTG. Deletion right flank: CTGTAGGTAAAGTGCTTCTATCCAGAATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40G9.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1784 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAGCCAGCAGTTTTCAAGG. External right primer: TTTCCAGTTGCCATAGTCCC. Internal left primer: GGAAACGTGCAAAATTCGTT. Internal right primer: ACTCGGCCTCTTCCATTTTT. Internal WT amplicon: 2481 bp. Deletion size: 1696 bp. Deletion left flank: ATTAGCAGACCCAAGTATGGTCTGCTAAATAATTAGC. Deletion right flank: TGCTAAATATTTAACAGACCCAAAACTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M176.1. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and ok536 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y22D7AL.5. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATTGATTTTTCCCGCTGA. External right primer: AGGGGAAAAAGAGCCGTAAA. Internal left primer: GAAATTTTGGTTTTCCTGCG. Internal right primer: CAAATGGCTCAGAGCACAAA. Internal WT amplicon: 1227 bp. Deletion size: 611 bp. Deletion left flank: AAAAATTTGAATTTTTCGTGAAAATTTGAA. Deletion right flank: GCTCTCAATCTCTCATTGAAATAACGACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R155.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk1217 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAGCAAATTTTTGCGGG. External right primer: AAGTACGCAAACACCTTGGC. Internal left primer: GCTAACTCGGCCTTTACACG. Internal right primer: TTTGGAAACCCGTTGGATTA. Internal WT amplicon: 2401 bp. Deletion size: 1464 bp. Deletion left flank: GTCGATTGGACCCAAAAAATAGAATTTTCA. Deletion right flank: GTGAAAAAGTACAAGAAATTCAACTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02F3.1, K02F3.12. Heterozygotes are WT, and segregate WT, Dpy sC1 homozygotes, and ok474 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R148.3. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3525 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGAGACAACAGTGAGCCGAC. External right primer: GCTGCCTTCCATGACTTCTC. Internal left primer: CTCATGCTCAACGTCAGGAA. Internal right primer: TGTCGATCGTCTTCTCATCG. Internal WT amplicon: 1190 bp. Deletion size: 862 bp. Deletion left flank: GACGGCGGAGAATCGAGATTTGACAGATAA. Deletion right flank: TCATCGATGAGAAGACGATCGACACGTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C1.4. External left primer: AACGATAGGAGACACGGTGG. External right primer: TGTGGTTGTTTTCGTTGCAT. Internal left primer: CAAGTTGAGAGTCCGCAGTG. Internal right primer: ACCATAAACTTGTTCGCGCT. Internal WT amplicon: 1143 bp. Deletion size: 523 bp. Deletion left flank: TTAGACAACTAACCATAGAGCGTGCAAATC. Deletion right flank: TGTTTCAGTGTTCTCCTTCCTGAAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y50D7A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3089 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTATCCGAATTTTCTGCGG. External right primer: ATTTTCAACGGAATTCGACG. Internal left primer: GAAAATTTTGCATTTTCAAGGC. Internal right primer: TCCGCGATTTTTATAGCATTTT. Internal WT amplicon: 940 bp. Deletion size: 647 bp. Deletion left flank: TTTTGTCAAGCCTCAAATCCCACAATTTTG. Deletion right flank: ATAAATGAGCCAAAATTCGTCAAATTCTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W07B3.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATAATCATGCCAGAAGTG. External right primer: ATCGAGCAGAATTTGTCCATTT. Internal left primer: ACACCTGAATCTGCTGCTGTT. Internal right primer: ACGAATTGAATGAAATCACGC. WT internal amplicon: 2021 bp. Deletion size: approximately 1100 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26D10.2. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and gk191 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W07B3.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3388 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATAATCATGCCAGAAGTG. External right primer: ATCGAGCAGAATTTGTCCATTT. Internal left primer: ACACCTGAATCTGCTGCTGTT. Internal right primer: ACGAATTGAATGAAATCACGC. Internal WT amplicon: 2021 bp. Deletion size: 296 bp. Deletion left flank: ATCCAGTGCTTCTCCGTTGATACGGCCTAT. Deletion right flank: CAAGTTTGGTATGGTAAATATTTAGCAGAC. Insertion Sequence: GTTTGGTATGGTAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59A2.4. Deletion balanced by glp-1 and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3753 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAACACCAATGGATTTGGC. External right primer: CCAGGCTTGCAAATAAGCTC. Internal left primer: AAAGTCAATTTCGGCCCATT. Internal right primer: TTGAGGACAAAACCTACCCG. Internal WT amplicon: 1279 bp. Deletion size: 698 bp. Deletion left flank: CCGAGAGCGCATACGTTGCCGAGAGCACTC. Deletion right flank: AAATCTATCTCTCTACGAAGCATTGTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK370.2. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3109 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCGCTGATTCCAGTCGTTT. External right primer: AGCTAAATCCGCACACGAAC. Internal left primer: TAAACAGCATGCGGTGGAAT. Internal right primer: TGAAAAATTTGGCTCCGAGT. Internal WT amplicon: 1222 bp. Deletion size: 707 bp. Deletion left flank: AATAACTTTGAGAGGGAAAAGGTTACGAAA. Deletion right flank: TCACTGAAGATTTTCGATATGGAGATTTTT. Insertion sequence: TCACTGAAGATTTTCGATATGTATTTGAGAGGGAAAAGGTTACGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1764 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGCGCGAGGATGATTTGAAACTGGCGCCC. Right flanking sequence: TGGAAGAACAATTGCTGCTTCTGACATTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

R148.6. Heterozygotes are WT, and segregate WT, Dpy sC1 homozygotes, and ok603 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1139 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAACAAATAATTAGCTGCCTCATTGCCT; Right flanking sequence: CATTTCATGTTCCATCACAGCCATATCGCT. See WormBase Variation gk5034 for details.

Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details.

Homozygous lethal deletion balanced by qC1. Deletion of 304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTACATTTTCAAAATTAAAGTATGGCCT ; Right flanking sequence: TGGCGAGAAGAGTGTTGAAGAGGCTGCTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion balanced by qC1. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: CAGATCTCAGACACAATGGTTGCCCAGAAT; Right flanking sequence: CCCGTCCAGCTGCTGTCGAAAAGAAAACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion balanced by qC1. Deletion of 1366 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: TCATTTTGTATAATGTTTTATTCTCGGTCA; Right flanking sequence: GGAGGTAGAATGCACTCGTATAAAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 502 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTCATTCTTTTTTCCTTCCGTTGCCGGTC. Right flanking sequence: TTCGGGTCTATTTTAATATTACTGTCCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F11C1.6. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok645 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T17H7.4d. Deletion balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy sC1 homozygotes, and ok689 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C38D4.6. Deletion balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok690 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W06E11.2, W06E11.5a. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked crossover suppressor. Heterozygotes are WT, and segregate WT, Dpy sC1 homozygotes, and ok476 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23H11.1. Homozygous viable deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1171 homozygotes (sickly, slow-growing). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42C1.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1456 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y6D11A.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1093 homozygotes (arrest stage/phenotype undetermined)). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATAAAAATTAGGTATTTCAGGTTTTCCA; Right flanking sequence: GGGTTACTGTAGACGAAATGAATCCGAAAA. sgRNA #1: AACAACTTGAAGGAACTCAA; sgRNA #2: CATAAATATTAAAGCCGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGGGAATTTGTTGTCTATTGCAAATCCA; Right flanking sequence: CGGACCAGTGGTTGCTCCGAGGTTGTTCAC. sgRNA #1: AAGGCTTTATATCCCGGTGG; sgRNA #2: CCGTCAATGGCCAAAGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.