| MT16762 |
C. elegans |
mir-256(n4471) V. Show Description
Complete deletion allele of mir-256 from bases 5826-6853 on T07H8. This mutation likely has a polar effect on mec-1, which starts at 6924 on T07H8 (the deletion covers putative promoter elements).
|
|
| MT1677 |
C. elegans |
unc-1(n494) lon-2(e678) X. Show Description
Semi-dominant Coiler Unc. Lon.
|
|
| MT1679 |
C. elegans |
unc-105(n490) II; lon-2(e678) let-2(n821) X. Show Description
Long. n821 pka sup-20(n821).
|
|
| MT1684 |
C. elegans |
unc-105(n490n785) II. Show Description
Non-Unc.
|
|
| MT16846 |
C elegans |
csp-1(n4967) II. Show Description
n4967 is a 769 bp deletion that removes the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
|
|
| MT16848 |
C. elegans |
mir-249(n4983) X. Show Description
Deletion breakpoints are:TGCCAACTGGATTGAACAAAACAACT / TGCACACAAGAGAGAGGTCCACCTAGCAA...AGATAAGTCGTACATCACTTTAT / CTGTTTAATGGATTAGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1685 |
C. elegans |
unc-105(n490n786) II. Show Description
Non-Unc.
|
|
| MT16973 |
C. elegans |
met-1(n4337) I. Show Description
Deletion of C43E11.3 splice donor for the 4th exon through exon 7.
|
|
| MT170 |
C. elegans |
egl-27(n170) II. Show Description
Egg laying defective. Retains late stage eggs. Males do not mate.
|
|
| MT171 |
C. elegans |
egl-34(n171) I. Show Description
Egg laying defective. Retains late stage eggs.
|
|
| MT17121 |
C. elegans |
set-17(n5017) II. Show Description
Reference: Development 134(16):2991-9 (2007).
|
|
| MT17136 |
C. elegans |
nDf67 IV; nDf58 X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT17137 |
C. elegans |
mir-51(n4473) IV; nDf58 X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT17143 |
C. elegans |
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X. Show Description
Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.
|
|
| MT1720 |
C. elegans |
unc-105(n490) II; let-2(n821) X. Show Description
n490sd: curly Unc, Sma. n821: WT revertant of n490; extragenic; pka sup-20. See Science 273: 361-364 1996.
|
|
| MT1727 |
C. elegans |
dpy-10(e128) lin-29(n482) II. Show Description
Dpy. Egg laying defective. Makes bags of worms. Abnormal vulva. Previously called egl-29(n482).
|
|
| MT17428 |
C. elegans |
mir-72(n4130) II; nDf47 X. Show Description
Reference: Curr Bio (2010) 20:367-73.
|
|
| MT17429 |
C. elegans |
nDf67 IV. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT1743 |
C. elegans |
ced-3(n718) IV. Show Description
n718 is a strong allele of ced-3.
|
|
| MT17431 |
C. elegans |
nDf49 II; nDf59 V; mir-247(n4505) X. Show Description
mir-44, mir-61, and mir-247 are members of the mir-44 family. mir-45 is also part of this family, but is not deleted in thsi strain; it is closely linked to mir-44. Reference: Curr Bio (2010) 20:367-73.
|
|
| MT17445 |
C. elegans |
mir-62(n4539) X. Show Description
993 bp deletion covering bases 11371-12364 of T07C5. Deletion covers mir-62 (11867-11890) and part of the predicted gene T07C5.6.
|
|
| MT17446 |
C. elegans |
mir-53(n4113) mir-52(n4100) IV; nDf58 X. Show Description
Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT17463 |
C. elegans |
set-25(n5021) III. Show Description
Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).
|
|
| MT176 |
C. elegans |
lin-1(n176) IV. Show Description
Strong Muv.
|
|
| MT17631 |
C. elegans |
nDf56 IV; nDf60 V. Show Description
Reference: Curr Bio (2010) 20:367-73.
|
|
| MT17676 |
C. elegans |
mir-45(n4280) II; nDf59 V; mir-247(n4505) X. Show Description
nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73.
|
|
| MT17810 |
C. elegans |
mir-1(n4102) I. Show Description
Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1784 |
C. elegans |
dpy-20(e1362) unc-31(e169) IV. Show Description
Dpy. Unc.
|
|
| MT17848 |
C. elegans |
mir-2(n4108) I; nDf49 II; nDf59 V; mir-247(n4505) X. Show Description
mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT1789 |
C. elegans |
sup-17(n316) I. Show Description
Dpy. Egl. Abnormal vulval cell lineages.
|
|
| MT1790 |
C. elegans |
unc-78(e1217) lin-18(e620) lon-2(e678) X. Show Description
Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture; temperature sensitive. Unc. Lon.
|
|
| MT1799 |
C. elegans |
lin-36(n766) unc-32(e189) III. Show Description
Unc.
|
|
| MT17997 |
C. elegans |
mir-235(n4504) I. Show Description
Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT180 |
C. elegans |
sup-9(n180) II. Show Description
Suppresses unc-93(e1500).
|
|
| MT1801 |
C. elegans |
lin-38(n751) unc-52(e444) II; lin-9(n112) III. Show Description
Unc. Muv.
|
|
| MT18016 |
C. elegans |
nDf63 III; mir-63(n4568) X. Show Description
Both deletions are homozygous by PCR. mir-63, mir-229, mir-64, mir-65, and mir-66 are related in sequence. nDf63 removes mir-229, mir-64, mir-65, and mir-66. nDf63 was outcrossed 6x; n4568 has been outcrossed 2x. Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.
|
|
| MT18023 |
C. elegans |
lin-4(e912) II; mir-237(n4296) X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT1803 |
C. elegans |
lin-8(n111) II; lon-1(e185) lin-37(n758) III. Show Description
Long. Muv.
|
|
| MT18037 |
C. elegans |
mir-75(n4472) X. Show Description
Deletion covering bases 34070-36042 on T24D8. This is a complete deletion of mir-75, which is on T24D8 (34374-34395).
|
|
| MT18043 |
C. elegans |
mir-240&mir-786(n4541) X. Show Description
Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1806 |
C. elegans |
lin-15A(n767) X. Show Description
WT phenotype. Synthetic Muv.
|
|
| MT1808 |
C. elegans |
lin-38(n751) II. Show Description
|
|
| MT18143 |
C. elegans |
nIs286 X. Show Description
nIs286 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
|
|
| MT18144 |
C. elegans |
nIs287 X. Show Description
nIs287 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
|
|
| MT18145 |
C. elegans |
nIs289 X. Show Description
nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
|
|
| MT1821 |
C. elegans |
lin-25(e1446) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Hets are Unc and segregate Unc, Vul and dead eggs. Maintain by picking Uncs.
|
|
| MT18409 |
C. elegans |
nDf53 III; mir-58.1(n4640) IV. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT18410 |
C. elegans |
mir-58.1(n4640) IV; nDf54 X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT1842 |
C. elegans |
lin-14(n536n838) X. Show Description
Vulva abnormal.
|
|
| MT1848 |
C. elegans |
lin-14(n360) X. Show Description
Temperature sensitive.
|
|
