| MT15873 |
C. elegans |
mir-240(n4541) X. Show Description
Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15883 |
C elegans |
csp-2(n4871) IV. Show Description
n4871 is a 1136 bp deletion that removes the last five exons, including the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
|
|
| MT15884 |
C elegans |
csp-3(n4872) I. Show Description
n4872 is a 722 bp deletion that removes part of exon 2 and all of exons 3 and 4. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
|
|
| MT15894 |
C elegans |
vps-50(n4022) III. Show Description
vps-50 mutants are abnormal in locomotion and egg laying. n4022 is a strong loss-of-function allele; unknown if null. Reference: Paquin N, et al. Curr Biol. 2016 Apr 4;26(7):862-71. doi: 10.1016/j.cub.2016.01.049. PMID: 26948874.
|
|
| MT1590 |
C. elegans |
egl-11(n587) unc-42(e270) V. Show Description
Temperature-sensitive Egl. Reference: Genetics (1983) 104:619-47.
|
|
| MT1593 |
C. elegans |
egl-23(n601) dpy-4(e1166) IV. Show Description
n601 is dominant: Egl, sluggish. e1166 is semidominant.
|
|
| MT15933 |
C. elegans |
flp-17(n4894) IV. Show Description
Weak suppressor of egl-6(n592). 945 bp deletion. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008, 11(10):1168-76.
|
|
| MT15934 |
C. elegans |
irk-1(n4895) X. Show Description
Egl-c. Suppresses egg-laying defect of egl-6(gf). Reference: Emtage L, et al. J Neurosci. 2012 Nov 14;32(46):16285-95. doi: 10.1523/JNEUROSCI.2667-12.2012. PMID: 23152612.
|
|
| MT15981 |
C. elegans |
mir-87(n4104) V; mir-233(n4761) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15982 |
C. elegans |
mir-67(n4899) III. Show Description
Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1600 |
C. elegans |
unc-8(e49) egl-21(n611) IV. Show Description
Temperature-sensitive Egl. Reference: Genetics (1983) 104:619-47.
|
|
| MT16012 |
C. elegans |
isw-1(n3297) III. Show Description
Wild-type vulva. Semi-sterile. Suppressor of lin-53(n833); lin-15(n767).
|
|
| MT16033 |
C. elegans |
mir-244(n4367) I. Show Description
Deletion breakpoints are: CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16060 |
C. elegans |
nDf64 V. Show Description
mir-253 and part of F44E7.5 are deleted in nDf64. Deletion breakpoints are:GATATCCTCACACTTTGGCAAAGAGTGCTT / GTTGAAGACGGTGAAAACATCCGAATTTTCAGGGAAGTT...TGAGATAAGAACACAAA GAATTCGATTTTC / GTGAATTCTGAACGAAACTTTACGTTTTGGACAGTAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16061 |
C. elegans |
mir-238(n4112) III; nDf62 X. Show Description
4x outcrossed autosomes; 2x outcrossed X chromosome. Homozygous by PCR. Reference: Curr Bio (2010) 20:367-73.
|
|
| MT16133 |
C. elegans |
set-24(n4909) II. Show Description
Reference: Development 134(16):2991-9 (2007).
|
|
| MT162 |
C. elegans |
egl-18(n162) IV. Show Description
Egg laying defective. Retains late stage eggs. Vulva abnormalities.
|
|
| MT16231 |
C. elegans |
nIs177 sptf-3(n4850) I. Show Description
nIs177 [ceh-28p::4NLS::GFP + lin-15(+)]. Extra ceh-28p::4NLS::GFP-expressing M4 seen in nIs177 (~30% penetrance). Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
|
|
| MT1624 |
C. elegans |
lin-35(n745) I; lin-8(n111) II. Show Description
Double mutant is Muv. lin-35 alone is non-Muv. lin-35 is a class B synthetic Muv.
|
|
| MT1628 |
C. elegans |
lin-9(n112) III; lin-15A(n749) X. Show Description
Synthetic Muv. n749 is lin-15 Class A allele.
|
|
| MT1630 |
C. elegans |
lin-38(n751) II; lin-9(n112) III. Show Description
Double mutant is Multivulva. lin-38 alone is non-Muv. lin-38 is a class A synthetic Muv.
|
|
| MT16308 |
C. elegans |
mir-252(n4570) II. Show Description
Deletion breakpoints are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16309 |
C. elegans |
mir-247&mir-797(n4505) X. Show Description
Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16310 |
C. elegans |
mir-269(n4641) IV. Show Description
Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16311 |
C. elegans |
mir-77(n4286) II. Show Description
Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16316 |
C. elegans |
mir-355(n4618) II. Show Description
Deletion breakpoints are:TGTGTCTATGAAATTAATTC / TTATATCAACTCTAATTAT...TTTTGGGAAAATGAAC / GATTAAACATTTTTTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16317 |
C. elegans |
mir-252(n4570) II; mir-251(n4606) X. Show Description
Deletion breakpoints for n4606 are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Deletion breakpoints for n4570 are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16335 |
C. elegans |
mir-251(n4606) X. Show Description
Deletion breakpoints are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16336 |
C. elegans |
mir-86(n4607) III. Show Description
Deletion breakpoints are:TCTACCGAACTTCGCATAAT / TTCCAATTTTCAATTTCCA...ACAATTTGAAAATAAAAA / TTTGCAGAAAAAGTTGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16337 |
C. elegans |
mir-245(n4798) I. Show Description
Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1635 |
C. elegans |
lin-8(n111) II; lin-37(n758) III. Show Description
Double mutant is Muv. n758 alone is not Muv.
|
|
| MT16426 |
C. elegans |
set-9(n4949) IV. Show Description
F15E6.1 Tandem deletion/duplication.
|
|
| MT16429 |
C. elegans |
set-6(tm1611) lin-15A(n767) X. Show Description
Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9.
|
|
| MT1643 |
C. elegans |
lin-36(n766) III; lin-15A(n767) X. Show Description
Double mutant is Muv. lin-36 alone is non-Muv.
|
|
| MT16430 |
C. elegans |
set-6(tm1611) lin-15B(n744) X. Show Description
Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9.
|
|
| MT16471 |
C. elegans |
mir-60(n4947) II. Show Description
Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16492 |
C. elegans |
uaf-1(n4588) III. Show Description
Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708.
|
|
| MT16494 |
C. elegans |
mir-229&mir-64&mir-65&mir-66(nDf63) III. Show Description
Deletion breakpoints are: TATTTGCCAAAAATGGAAATTTT / CGGCAAATCGGGAAGCC...AGCTCGTCGGAAGCAATTG / GCTCCGCGTAATTGGAGCCCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16506 |
C. elegans |
mir-254(n4470) X. Show Description
Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1652 |
C. elegans |
unc-8(n773) IV. Show Description
Semi-dominant Unc.
|
|
| MT16529 |
C. elegans |
lin-61(n3447) I; lin-15A(n767) X. Show Description
SynMuv B. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT16530 |
C. elegans |
lin-61(n3447) I; lin-8(n2731) II. Show Description
Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT16532 |
C. elegans |
lin-61(n3447) I; lin-38(n751) II. Show Description
Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT1655 |
C. elegans |
bli-6(n776) IV. Show Description
Blistered cuticle. Dominant.
|
|
| MT1656 |
C. elegans |
unc-108(n777) I. Show Description
Dominant Unc.
|
|
| MT16696 |
C. elegans |
mir-244(n4367) I. Show Description
Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1670 |
C. elegans |
unc-1(n494) dpy-3(e27) X. Show Description
Dpy Unc. Semi-dominant Unc.
|
|
| MT1671 |
C. elegans |
unc-1(n496) lon-2(e678) X. Show Description
Dominant Coiler Unc. Lon.
|
|
| MT1672 |
C. elegans |
unc-8(n491) dpy-4(e1166) IV. Show Description
Dpy. Unc.
|
|
| MT1676 |
C. elegans |
unc-70(n493) dpy-11(e224) V. Show Description
DpyUnc. Semidominant Unc.
|
|
