Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CY251 C. elegans sqt-1(sc13) age-1(mg44) II; bvIs2. Show Description
bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CY262 C. elegans sqt-1(sc13) age-1(mg44) II; bvIs1. Show Description
bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CY397 C. elegans daf-16(mg242) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg242) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg242 is a nonsense mutation Trp220Amb.
CY398 C. elegans daf-16(mg255) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.
CY573 C. elegans bvIs5. Show Description
bvIs5 [cyp-35B1p::GFP + gcy-7p::GFP]. Little or no GFP expression in adults. GFP expressed in intestine of dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.
CY577 C. elegans bvIs6. Show Description
bvIs6 [cat-4p::GFP + gcy-7p::GFP]. GFP localized to intestine, neurons and hypodermis in adults. GFP localized to neurons and seam cells in dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.
CYA23 C. elegans ahcy-1(syb748) I; sqIs13. Show Description
sqIs13 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. GFP fluorescence in autophagosomes. RFP fluorescence in AWB and AWC. ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.
CZ10123 C. elegans rabx-5(qa7800) III. Show Description
rabx-5(qa7800) mutants show decreased protein localization of YFP::RAB-5 in the cell bodies but increased protein localization within the dorsal cord in both synaptic and intersynaptic regions
CZ1072 C. elegans unc-62(e917) V. Show Description
Inversion which may serve as a balancer for the center of LG V. Maternal effect lethal allele which results in 57% embryonic arrest, 40% larval arrest, and 3% which survive to be fertile adults with a variety of defects including Egl, Unc and Vab.
CZ1566 C. elegans lin-15B&lin-15A(n765) juIs109 X. Show Description
juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.
CZ16518 C. elegans juEx4796. Show Description
juEx4796 [col-19p::mito::GFP + ttx-3p::RFP]. Pick animals with red fluorescence to maintain array. Transgenic animals express mito::GFP in the hypodermis. Reference: Fu H, et al. Nat Commun. 2020 Feb 26;11(1):1050. PMID: 32103012.
CZ1774 C. elegans vab-1(e856) ptp-3(op147)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.
CZ18412 C. elegans juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ2060 C. elegans juIs137 II. Show Description
juIs137 [flp-13p::snb-1::GFP] II. GFP expression labels synaptic vesicles. Reference: Sakaguchi-Nakashima A, et al. Curr Biol. 2007 Apr 3;17(7):592-8. doi: 10.1016/j.cub.2007.01.074. PMID: 17346966.
CZ22190 C. elegans rpm-1(ok364) rpms-1(ju1285) V. Show Description
ju1285 is a deletion in F07B7.12/rpms-1. Reference: Sun Y, et al. MicroPubl Biol. 2024 Dec 5;2024:10.17912/micropub.biology.001396. doi: 10.17912/micropub.biology.001396. PMID: 39712931.
CZ22695 C. elegans juEx6908. Show Description
juEx6908 [nmr-1p::PH::miniSOG(Q103L) + nmr-1p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Interneuron expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22698 C. elegans juEx6911. Show Description
juEx6911 [unc-25p::PH::miniSOG(Q103L) + unc-25p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in GABAergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22703 C. elegans juEx6916. Show Description
juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22714 C. elegans miro-3(ju1310) juSi271 I; miro-1(ju1306) IV; miro-2(ju1309) X. Show Description
juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6.
CZ2274 C. elegans efn-4(bx80) efn-2(ev658) IV; efn-3(ev696) X. Show Description
bx80 was previously called mab-26(bx80): Extensive ray fusion involving all 9 rays; Larva have Vab phenotype with decreasing expressivity in adult; Hermaphrodites have swollen tail and anus. Vab, embryonic ventral enclosure defects, male ray fusions. Slow growth.
CZ23277 C. elegans juEx7101. Show Description
juEx7101 [col-19p::PH::miniSOG(Q103L) + ttx-3::RFP]. Pick RFP+ to maintain. Adult epidermal expression of PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ23279 C. elegans juEx7103. Show Description
juEx7103 [unc-17p(beta)::PH::miniSOG(Q103L) + acr-2p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in cholinergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. [NOTE: strain was previously described as carrying ttx-3::GFP, but appears to be ttx-3::RFP instead.]
CZ23281 C. elegans juEx7105. Show Description
juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ23908 C. elegans rab-8(tm2526) I; muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Homozygous viable. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420
CZ24092 C. elegans gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
CZ24274 C. elegans dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
CZ24969 C. elegans sphk-1(ju831) II. Show Description
Aldicarb resistant. Reference: McCulloch KA, et al. G3 (Bethesda). 2017 Jul 5;7(7):2055-2063.
CZ24990 C. elegans unc-44(ju1412[unc-44::GFP]) IV. Show Description
Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ25013 C. elegans unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ25708 C. elegans prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
CZ2611 C. elegans vab-2(ju1) efn-2(ev658) IV; efn-3(ev696) X. Show Description
vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal), and was previously called efn-1. Vab, embryonic ventral enclosure defects, male ray fusions.
CZ26606 C. elegans vwa-8(ju1659) X. Show Description
Superficially wild-type. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263
CZ26660 C elegans micu-1(ju1155) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
CZ27190 C. elegans juIs550. Show Description
juIs550 [mec-4p::mito::GCaMP5 + ttx-3p::RFP]. Mitochondrial calcium reporter expressed in touch neurons. Reference: Tang NH, et al. Curr Biol. 2020 Mar 9;30(5):865-876.e7. doi: 10.1016/j.cub.2019.12.061. PMID: 31983639
CZ27508 C elegans micu-1(ju1783[micu-1::gfp]) IV. Show Description
GFP reporter inserted into C-terminus of endogenous micu-1 locus. Diffuse GFP signals throughout the body. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
CZ27748 C. elegans vwa-8(ju1799[vwa-8::GFP::3xFLAG]) X. Show Description
Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263.
CZ29001 C. elegans muIs32 II; degt-1(ok3307) V. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]
CZ3103 C. elegans juIs167. Show Description
juIs167 [vab-19::GFP + rol-6(su1006)]. Integrated by UV/TMP. Rollers. Received new stock Feb 2005.
CZ333 C. elegans juIs1 IV. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.
CZ337 C. elegans vab-1(dx31) II. Show Description
Strong Vab-1 phenotype. About 50% embryonic lethality and about 30% larval lethality. Genetic null.
CZ3391 C. elegans vab-3(ju468) X. Show Description
Vab. Notched Head. Distal tip cell Mig. Male tail ray and spicule defects. Males do not mate. About 50% larval lethality. H and B cell lineage defects. Received new stock Jan. 2006.
CZ3464 C. elegans juIs176. Show Description
juIs176 [IFB-1a::GFP + rol-6(su1006)]. Some worms don't roll. GFP expression patterns are similar to MH4 staining.
CZ375 C. elegans vab-1(e856) II. Show Description
CZ3761 C. elegans ptp-3(mu256) II. Show Description
Low penetrance tail Vab and embryonic lethality.
CZ401 C. elegans vab-19(e1036) II. Show Description
Cold sensitive lethal. Vab at 20 and 25C.
CZ4019 C. elegans juEx595. Show Description
juEx595 [IFB-1b::GFP + rol-6(su1006)]. Maintain by picking Rollers. GFP expression patterns are similar to MH4 staining. Maintain by picking rollers.
CZ4111 C. elegans vab-2(ju1) IV. Show Description
vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.
CZ414 C. elegans vab-1(e699) II. Show Description
Intermediate Vab-1 phenotype. About 9% embryonic lethality and about 20% larval lethality. CB699 outcrossed 2X to N2 to make CZ414.
CZ419 C. elegans dapk-1(ju4) I. Show Description
Abnormal head morphology, slightly temperature sensitive. Maintain under normal conditions. Reference: Tong A, et al. Proc Natl Acad Sci U S A. 2009 Feb 3;106(5):1457-61.
CZ4280 C. elegans eps-8(jc36)/unc-26(e205) dpy-4(e1166) IV. Show Description
Heterozygotes segregate wild-type heterozygotes, Emb, and Unc Dpy. Maintain by picking wild-type.