Search Strains

More Fields
Strain Species Genotype Add
EG9891 C. elegans unc-119(ox819) III; W03F9.11(oxTi1121) V. Show Description
oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
GS9402 C. elegans arTi362 Show Description
arTi362 [rps-27p::TIR1(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (-19.98). The first intron of TIR1 was replaced with a Flexon containing two lox2272 sites. TIR1 is expressed at a high level in lineages where Cre is expressed. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9407 C. elegans arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I (-12.74). First intron of GFP is replaced with a Flexon containing two lox2272 sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Transgene maps to -12.74 (I). Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology.
GS9801 C. elegans rde-1(ar660) V. Show Description
rde-1(ar660)[rde-1(lox2272-flexon-lox2272)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.
GS9820 C. elegans arTi443 Show Description
arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (+21.99). The first intron of TIR1(F79G) was replaced with a Flexon containing two lox2272 sites. TIR1(F79G) is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GT330 C. elegans aSi8 II; unc-119(ed3) III. Show Description
aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT332 C. elegans aSi10 II; unc-119(ed3) III. Show Description
aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
GT337 C. elegans aSi13 II; unc-119(ed3) III. Show Description
aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST]?II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
GT347 C. elegans aSi23 II; unc-119(ed3) III. Show Description
aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT350 C. elegans aSi26 II; unc-119(ed3) III. Show Description
aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT372 C. elegans aSi31 II; unc-119(ed3) III Show Description
aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT375 C. elegans aSi27 II; unc-119(ed3) III. Show Description
aSi27 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7s::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7s in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT377 C. elegans aSi36 II; unc-119(ed3) III. Show Description
aSi36 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7f::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
MSB1091 C. elegans mirSi16 II; unc-119(ed3) III; mirIs110 V; mirIs107. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. mirIs107 [gpa:14p::CRE + npr-9p::ChR-HRDC::YFP::SL2::jRGECO1a + rps-0p::hygroR]. Blue fluorescence in flp-18 expressing neurons. Green coelomycetes segregates with calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in AWA. ChR2-HRDC and jRGECO1a in AVA (instead of BFP) and ChR2-HRDC::YFP and jRGECO1a in AIB. HygroR. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB1160 C. elegans mirSi16 II; unc-119(ed3) III. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB486 C. elegans mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB609 C. elegans mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirIs47. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs47 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Blue fluorescence in flp-18 expressing neurons. loxP sites before first (eat-4(mir12[loxP 5'UTR])) and after second exon (eat-4(mir17[loxP intron2])) of eat-4 gene. Lite. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB. Conditional eat-4 KO in ASH (NOT defective) and ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB861 C. elegans mirSi16 II; mirIs76; mirEx69. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs76 [sra-6p::ChRmine::wrmScarlet::let-858 3UTR + sra-6p::TeNL]. mirEx69 [gpa:14p::CRE + unc-122p::mCherry]. Mantain by picking animals with mCherry+ coelomycetes. Blue in flp-18 expressing neurons. Expression of ChRmine, wrmScarlet and calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ. Expression of ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB961 C. elegans mirSi29 II; unc-119(ed3) III. Show Description
mirSi29 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ACR1 and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB966 C. elegans mirSi34 II; unc-119(ed3) III. Show Description
mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB985 C. elegans mirSi37 II; unc-119(ed3) III. Show Description
mirSi37 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChRmine and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
PX736 C elegans fxSi13 III. Show Description
fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).
SV2071 C. elegans he317[eft-3p::Lox2272::egl-13-NLS::tagBFP2::let-858 3'UTR::Lox2272::egl-13-NLS::mCherry::let-858 3'UTR] IV; heSi220 X. Show Description
heSi220 [lin-31p::Cre] X. Vulval lineage is marked through activity of a Cre-dependent reporter (blue-to-red switch). All cells in the animal are expressing BFP, except for vulval cells which are expressing mCherry. he317 was inserted into the cxTi10816 site using CRISPR/Cas9. Reference: van der Vaart A, et al. Sci. Adv. 2020 May; 6(21): eaay3823. PMID: 32494730.