Search Strains

Abnormal response to infection by Microbacterium nematophilum (no tail swelling).

eEx512 [dpy-31(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal dpy-31 mutant rescued by array containing dpy-31(+) 6.5 kb fragment. Reference: Novelli et al. (2004) PMID: 15579684.

Viable dumpy. Suppressor allele of dpy-17: lethality of dpy-31(e2770) suppressed by e2898. Reference: Novelli et al. (2006) PMID: 16452136.

Weak dumpy. Lethal dpy-31 mutation suppressed by dpy-17 mutation. Reference: Novelli et al. (2006) PMID: 16452136.

eIs101 [dpy-17(E301K) + unc-119(+)]. Weakly dumpy, non-Unc. dpy-31 lethality suppressed by integrated dpy-17(gf) transgene. Reference: Novelli et al. (2006) PMID: 16452136.

Bus (resistant to infection by M. nematophilum), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al (in preparation).

Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2737 is a ~4.5 kb deficiency which removes all of the bus-10 exons, internal ncRNA genes ZK596.4 & ZK596.5, and ZK596.1. Reference: O'Rourke et al (in preparation).

Bus, bleach-sensitive, resistant to Leucobacter Verde2 and Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).

Him. Bus (resistant to M. nematophilum); hypersensitive to Leucobacter Verde1. References: Gravato-Nobre et al. (2005) PMID: 16079230. Hodgkin et al (in preparation).

Intragenic missense revertant. Partly resistant to Leucobacter Verde1. Reference: Stroud et al. (2013) IWM2013Abstract. ptr-15 also known as bus-13.

Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al (in preparation).

umnIs79 [myo-2p::GFP + NeoR, I: 6284001] I. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, arrested hT1 homozygotes (GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.

umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.

umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.

Roller Unc. e754 is cold-sensitive: lethal at 15C.

Heterozygotes are WT and segregate WT and dead eggs. (Chromosome carrying unc-42 ama-2 is homozygous lethal.) Strain is resistant to _-amanitin.

DpyUnc.

Temperature sensitive dauer constitutive. Dpy. Unc.

Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.

Heterozygotes are WT.

Heterozygotes are WT and lay 10/16 dead eggs. spn-4 unc-42 homozygotes are Unc and lay dead embryos exhibiting defects in mitotic spindle orientation and cell fate patterning. spn-4(or25) homozygotes are non-conditional maternal effect embryonic lethal.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs. Throws males.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. t1550 pka pnm-1(t1550).

Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Heterozygotes are Unc and segregate Uncs and dead eggs. nT1 carries a dominant Unc mutation and a recessive lethal mutation. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Steriles with an Everted Vul and DpyUncs. Received new stock 10/2003. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Steriles with an Everted Vul and DpyUncs. Do not distribute this strain; other labs should request it from the CGC. ar105 previously called evl-5(ar105).

Unc. At 25C ar39 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar39 recessively suppresses vulval lineage defects and proximal mitosis. Do not distribute this strain; other labs should request it from the CGC.

The double heterozygote is WT. WT will segregate WT, DpyUncs, mid-larval lethal (hT1 homozygotes) and dead eggs. The DpyUncs are homozygous for zu155 and zu148 and will segregate only dead embryos; the dead embryos have excess hypodermis and muscle and lack germ cells and intestine.

Heterozygotes are WT and segregate WT, Uncs, Vul and dead eggs. Uncs are homozygous for zu148 and will segregate only dead embryos; the dead embryos will have no morphogenesis and will lack germ cells and intestine.

Segregates glowing heterozygotes and DpyUncs. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.

daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047

Pick wild-type to maintain. Segregates wild-type, Dpy Unc, arrested hT1 homozygotes, and dead eggs. Reference: McKim KS, et al. Genetics. 1988 Dec;120(4):987-1001.

Pick wild-type to maintain. Segregates wild-type, Dpy Unc, arrested hT1 homozygotes, and dead eggs. Reference: McKim KS, et al. Genetics. 1988 Dec;120(4):987-1001. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Pick wild-type to maintain. Segregates wild-type, Dpy Unc, arrested hT1 homozygotes, and dead eggs. Reference: McKim KS, et al. Genetics. 1988 Dec;120(4):987-1001.

lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.

Gonad & rachis defects. Grow at 20 C.

lqIs170 [F25B3.3p::vab-10(ABD)::GFP + ttx-3::RFP] X. Pan-neuronal GFP expression. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.

Egl Unc. n586 is a temperature sensitive allele.

Temperature-sensitive Egl. Reference: Genetics (1983) 104:619-47.

Unc. Dominant Egl.

Unc. Posterior half thin and pale.

Hets are Unc (n754) and segregate Unc (n754), Unc(e270)Sqv and dead eggs. n2827: mid-L4 vulva abnormal, sterile.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous lethal, heterozygous animals might grow slower than wild-type. Deletion of 1188 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type mKate2+GFP+, and segregate wild-type mKate2+GFP+, arrested GFP+ non-mKate2 (rpl-4 homozygotes), arrested non-GFP mKate2+ (hT1 homozygotes), and dead eggs. Maintain by picking wild-type mKate2+ and GFP+. Left flanking Sequence: ATTTCTTCACGTTGGCCTTTGAAGCCTTGC ; Right flanking sequence: Ttattacctgcaatcaacagaaatagtaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. B0261.1. Homozygous Let. Deletion of 4055 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve560 homozygotes),  non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AATGCACAATTTGCATCTCCAAATCCGCCA ; Right flanking sequence: ccgttattttacgactgtcaaatctccatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 2016 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve567 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: cagcacaaatagaatATGAGCGCTCCCGCA ; Right flanking sequence: GGTGGATGTTTCTACTCGCAATTCCAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.