| OH10053 |
C. elegans |
unc-119(ed3) III; sox-2(ot640[unc-119(+)]) X; otEx4454. Show Description
otEx4454 [sox-2(fosmid)::mCherry + elt-2p::DsRed]. ot640 was generated by using MosDel removing the entire sox-2 locus and insert unc-119(+). ot640 homozygous arrest in L1 with a pharynx unattached (Pun) phenotype. Maintain by picking WT to maintain (transgene should be required for viability). Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
|
|
| OH10712 |
C. elegans |
pha-1(e2123) III; otEx4794. Show Description
otEx4794 [del-1p(2.6kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
|
|
| OH10754 |
C. elegans |
pha-1(e2123) III; otEx4818. Show Description
otEx4818 [del-1p(2.6kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
|
|
| OH17657 |
C. elegans |
unc-39(syb4537ot1193[unc-39p(bs_del)::unc-39::gfp]) V. Show Description
ot1193 is a CRISPR-engineered mutation of a small unc-39 auto-regulatory region containing a cluster of several predicted homeodomain binding sites in the endogenously-tagged unc-39(syb4537) reporter strain. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH3313 |
C. elegans |
oyIs14 V; otIs37 X. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otIs37 [unc-47(del)::GFP]. GFP fluorescence in PVT and DBV.
|
|
| OH3314 |
C. elegans |
oyIs14 V; otIs38 X. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otIs38 [unc-47(del)::GFP]. otIs38 is integrated juEx60 [(pCZ114) unc-47(del)::GFP]. GFP fluorescence in PVT and DBV.
|
|
| OP50-GFP |
Escherichia coli |
E. coli. Show Description
Bacteria. A strain of OP50 that contains a GFP plasmid (pFPV25.1) that is very fluorescent. Resistant to ampicillin. Originally published in Caenorhabditis elegans is a model host for Salmonella typhimurium. Labrousse A, Chauvet S, Couillault C, Kurz C, Ewbank J. Curr Biol. 2000 Nov 30;10(23):1543-5.
|
|
| PHX6862 |
C. elegans |
ifet-1(syb6862[ifet-1(del CHD)::mMaple *dfw15]) III. Show Description
Deletion of the cup homology domain (CHD; 196-217aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
|
|
| PHX6886 |
C.elegans |
ifet-1(syb6862[ifet-1(del PolyQ)::mMaple *dfw15]) III. Show Description
Deletion of the Poly Q region (PolyQ; 527-644aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
|
|
| PHX6949 |
C elegans |
ifet-1(syb6949[ifet-1(del NLS)::mMaple *dfw15]) III. Show Description
Deletion of the Nuclear Localization Sequence (NLS; 220-235aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. No embryonic viability defect in hermaphrodites. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
|
|
| PHX6954 |
C.elegans |
ifet-1(syb6862[ifet-1(del CC)::mMaple *dfw15]) III. Show Description
Deletion of the coiled coil domain (CC; 664-691aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
|
|
| QX1409 |
C. elegans |
qqIR7 (I: peel-1(qq99), EG4348>N2); ttTi5605 II; unc-119(ed3) III. Show Description
Nonsense allele of peel-1 carried in Utah isolate EG4348 crossed into N2 Bristol background. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115.
|
|
| RB1979 |
C. elegans |
del-3(ok2613) I. Show Description
F26A3.6. Homozygous. Outer Left Sequence: TCATCGCTTCTACGTGCATC. Outer Right Sequence: ATAATTGGAAGGGTTTCCCG. Inner Left Sequence: TAGCCCCCTACACCTCACAG. Inner Right Sequence: TAAATCGGCACCTGCTTTC. Inner Primer PCR Length: 1222 bp. Deletion Size: 350 bp. Deletion left flank: TATATAAATAAGACACAACTGGCGTCGATT. Deletion right flank: ATAATCAGCTGCTTCACGAAGCGATGGATT. Insertion Sequence: TCGTGAAAGCAGCTGATTACGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RG3343 |
C. elegans |
marc-5(ve843[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 6603 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. This indel also deletes tRNA Y57A10B.t1. Left flanking Sequence: GGGTAAGAAGGACCATAAGCCTACTCGAGC ; Right flanking sequence: CTGATGCTGCAAAAATTAGAAAAAATACGT. marc-5 sgRNA #1: ACAATCACAGAACTCCGCAG; marc-5 sgRNA #2: TATTTGTCTCAACAACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3465 |
C. elegans |
col-14(ve965[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1019 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATATTCAAACTTTGGAATCTCAAGTTCA ; Right flanking sequence: aggataattttgatttgtatacttacgttt. Note that col-14 resides in the 6th intron of C46A5.4 and it is not known whether this indel alters its expression. col-14 sgRNA A: ACTTGATCTTGAATTCTGCC; col-14 sgRNA B: tgtttgtatcgaaaatctgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3480 |
C. elegans |
col-123(ve980[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1079 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. The indel of col-123 resides within an intron of catp-6. It is not known if ve980 affects catp-6 expression or function. Left flanking Sequence: ggaaatgatgggaatattttcagagttcct ; Right flanking sequence: AGGTGGAGGCGGCGGAGGCGGAGAATACAA. col-123 sgRNA A: ATGACACTTGCATtctatac; col-123 sgRNA B: TCTCATGGTGGTTCATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3527 |
C. elegans |
maph-1.2(ve1027[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 4123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCAATAAATTTACTCGGGGGGAAAAATAA ; Right flanking sequence: TGGAAGCTAGTATTTCTGGTTATTTTTAGA. maph-1.2 crRNA A: TAAATAAGTTATGCgggggg; maph-1.2 crRNA B: AATCAATACGCCACTTCTAT. [NOTE: maph-1.2 shares sequence identity with other loci on LGIII and LGIV. Classical genetic mapping was performed confirm the location of the INDEL in LGI.] Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| SSM596 |
C. elegans |
rpa-1(iow117)/mIn1[mIs14 dpy-10(e128)] II. Show Description
Crispr/Cas9-engineered indel in the 5’ region of rpa-1. Larval-lethal mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP iow117 homozygotes (larval lethal). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. iow117 was generated in mre-11::GFP background and outcrossed to N2. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.
|
|
| ST2365 |
C. elegans |
ncEx2365. Show Description
ncEx2365 [del-1p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
|
|
| SU265 |
C. elegans |
jcIs17. Show Description
jcIs17 [hmp-1p::hmp-1::GFP + dlg-1p::dlg-1::DsRed + rol-6(su1006)]. Rollers. References: Zaidel-Bar R, et al. J Cell Biol. 2010 Nov 15;191(4):761-9. Raich WB, et al. Curr Biol. 1999 Oct 21;9(20):1139-46.
|
|
| VC831 |
C. elegans |
del-8(ok1357) X. Show Description
C11E4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VK1104 |
C. elegans |
vkEx1104. Show Description
vkEx1104 [nhx-2p::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1241 |
C. elegans |
vkEx1241. Show Description
vkEx1241 [nhx-2p::mCherry::lgg-1 + myo-2p::GFP]. Diffuse mCherry expression in intestine. GFP+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1243 |
C. elegans |
vkEx1243. Show Description
vkEx1243 [nhx-2p::ubiquitin-V::mCherry + myo-2p::GFP]. Increased Ub-tagged mCherry accumulation upon blockage of the proteosome by RNAi. Faint mCherry expression in intestine. GFP+ pharynx. References: Miedel MT, et al. PLoS One. 2012;7(7):e40145. Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460. Dantuma NP, et al. Nat Biotechnol. 2000 May;18(5):538-43.
|
|
| VK1244 |
C. elegans |
vkEx1244. Show Description
vkEx1244 [nhx-2p::ubiquitin-Met::mCherry + myo-2p::GFP]. mCherry behaves as an umodified cytosolic protein upon ubiquitin cleavage due to the absence of a degredation signal (N-terminal methionine). Diffuse mCherry expression in intestine. GFP+ pharynx. References: Miedel MT, et al. PLoS One. 2012;7(7):e40145. Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460. Dantuma NP, et al. Nat Biotechnol. 2000 May;18(5):538-43.
|
|
| VK1256 |
C. elegans |
vkEx1256. Show Description
vkEx1256 [nhx-2p::cpl-1::YFP + nhx-2p::DsRed::KDEL]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1258 |
C. elegans |
vkEx1258. Show Description
vkEx1258 [nhx-2p::cpl-1(W32AY35A)::YFP + nhx-2p::DsRed::KDEL]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1260 |
C. elegans |
vkEx1260. Show Description
vkEx1260 [nhx-2p::cpl-1::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1770 |
C. elegans |
vkEx1770. Show Description
vkEx1770 [nhx-2p::F13D12.6::YFP + nhx-2p::DsRed::KDEL]. YFP+ intestine. Reticular dsRed expression in intestine. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1870 |
C. elegans |
vkEx1870. Show Description
vkEx1870 [nhx-2p::F13D12.6(G166R)::YFP + myo-2p::mCherry]. YFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1879 |
C. elegans |
vkEx1879. Show Description
vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1984 |
C. elegans |
unc-51(e369) V; vkEx1879. Show Description
vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK2748 |
C. elegans |
vkEx2748. Show Description
vkEx2748 [nhx-2p::CemOrange2::tram-1 + nhx-2p::GFP::KDEL]. Wild-type animals expressing CemOrange2::TRAM-1 and GFP::KDEL under the intestinal-specific nhx-2 promoter. Pick GFP+ to maintain Reference: Thomas
|
|
| VK689 |
C. elegans |
vkIs689. Show Description
vkIs689 [nhx-2p::sGFP::ATM + myo-2p::mCherry]. Diffuse GFP expression in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK694 |
C. elegans |
vkIs694. Show Description
vkIs694 [nhx-2p::sGFP::ATZ + myo-2p::mCherry]. GFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK737 |
C. elegans |
vkEx737. Show Description
vkEx737 [hsp-4p::GFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VS30 |
C. elegans |
hjSi158 I. Show Description
hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3'UTR ]. Targeting construct derived from pCFJ352. Reference: Klemm RW, et al. Cell Rep. 2013 May 30;3(5):1465-75.
|
|
| VZ184 |
C. elegans |
vzEx60. Show Description
vzEx60 [dnj-27p(2kb)::dnj-27::YFP::KDEL]. Superficially wild-type. Pick YFP+ to maintain. Fluorescence should be easily detected under a dissection scope if present, but array has low transmission rate. Reference: Muñoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235.
|
|
| WLZ1 |
C. elegans |
wlzIs1. Show Description
wlzIs1 [snb-1p::Hsa-LRRK2 + lin15(+)]. Maintain at 15-20C. Can be used as a nematode model for Parkinson's Disease. Reference: Saha et. al., J Neurosci. 2009 Jul 22;29(29):9210-8.
|
|
| WLZ3 |
C. elegans |
wlzIs3. Show Description
wlzIs3 [snb-1p::Hsa-LRRK2(G2019S) + lin15(+)]. Maintain at 15-20C. Can be used as a nematode model for Parkinson's Disease. Reference: Saha et. al., J Neurosci. 2009 Jul 22;29(29):9210-8.
|
|
| WRM113 |
C. elegans |
mex-3(spr37) I. Show Description
Homozygous fertile, reduced brood at 25C. mex-3(spr37) is a CRISPR/Cas9 engineered indel removing nucleotides 28-651 of the mex-3 3’ UTR and inserting the sequence 5’-TTCATTCCAATT-3’ between break points. Displays temperature-sensitive embryonic lethality phenotype at 25C seen in other mex-3 3’ UTR deletion strains, though less penetrate than observed in GFP-tagged mutants. Derived in N2 background. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
|
|
| XT3 |
C. elegans |
cln-3.3(gk118) V. Show Description
Derived from VC146. Made as model for Batten disease. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT4 |
C. elegans |
cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Made as model for Batten disease. Derived from XT1 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT5 |
C. elegans |
cln-3.2(gk41) I; cln-3.1(pk479) V. Show Description
Made as model for Batten disease. Derived from XT1 and XT2. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT6 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) V. Show Description
Made as model for Batten disease. Derived from XT2 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT7 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Decreased brood size, mild life-span reduction. Made as model for Batten disease. Derived from XT2 and XT4. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| ZM5838 |
C. elegans |
hpIs223. Show Description
hpIs223 [rgef-1p::GFP::FUS + lin-15(+)]. GFP expression in neurons. Essentially wild-type movement; slight difference compared to N2 animals. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393.
|
|
| ZM5842 |
C. elegans |
hpIs228. Show Description
hpIs228 [rgef-1p::GFP::FUS[R522G] + lin-15(+)]. GFP expression in neurons. Slow motor activity compared to animals expressing wild-type GFP::FUS under the same promoter. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393.
|
|
| ZM5844 |
C. elegans |
hpIs233. Show Description
hpIs233 [rgef-1p::GFP::FUS[P525L] + lin-15(+)]. GFP expression in neurons. Slow motor activity compared to animals expressing wild-type GFP::FUS under the same promoter. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393.
|
|
| ZU279 |
C. elegans |
unc-119(ed3) III; czIs110. Show Description
czIs110 [mex-5p::GFP::KDEL::pie-1 3’UTR + unc-119(+)]. GFP::KDEL is a marker of the luminal ER in the embryo. Reference: Lee et al., J Cell Biol. 2016 Sep 12;214(6):665-76.
|
|