Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
BC11061 C. elegans dpy-5(e907) I; sEx11061. Show Description
sEx11061 [rCes F39B2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
RB2392 C. elegans F39B2.1(ok3262) I. Show Description
F39B2.1 Homozygous. Outer Left Sequence: gatccatcacgccaactttt. Outer Right Sequence: aaattcggtagatttgggca. Inner Left Sequence: gcaaggacgagttcgttgat. Inner Right Sequence: tctttggatcgtcttgaatgc. Inner Primer PCR Length: 1132. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW11656 C. elegans unc-119(tm4063) III; stIs11656. Show Description
stIs11656 [F39B2.1::H1-wCherry + unc-119(+)].
RW12232 C. elegans F39B2.1(st12232[F39B2.1::TY1::EGFP::3xFLAG]) I. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
VC2071 C. elegans F39B2.1(gk3174) I. Show Description
This strain is homozygous for a deletion (gk3174) in F39B2.1, detectable by PCR using the following primers. External left primer: CCGGTAGTAGCTTTCCCCTC. External right primer: AAGTCGCATAAGTCCATCGG. Internal left primer: ATATCAACCATCCAGCCAGC. Internal right primer: CGTCAGAATGGTACACAGCG. Internal WT amplicon: 2358 bp. Deletion size: approximately 450 bp. Validation: gk3174 passed by CGH. Left deleted probe: CATGGTCGCGACGAGGCTCAATCTGATCCATCACGCCAACTTTTGTTTAA. Right deleted probe: GATAGAATTCAACAGAATTTTTCGAGTGAGTAAGGATTTCTGGACAGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3276 C. elegans F39B2.1&F39B2.12(gk3170) I; gkDf39 X. Show Description
This strain is homozygous for a deletion (gk3170) in F39B2.1 and F39B2.12, detectable by PCR using the following primers. External left primer: CCGGTAGTAGCTTTCCCCTC. External right primer: AAGTCGCATAAGTCCATCGG. Internal left primer: ATATCAACCATCCAGCCAGC. Internal right primer: CGTCAGAATGGTACACAGCG. Internal WT amplicon: 2358 bp. Deletion size: 1150 bp. Deletion left flank: GCGGTGCTTCGAATTTATTTATAACATTCA. Deletion right flank: CGCTCGTCACCACAGCGGTGAGAAGGTGCT. Validation: gk3170 passed by CGH. Other deletion (gkDf39) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2415 C. elegans mtx-1(ok3155) I. Show Description
F39B2.11. External left primer: GATTTTGTCGTCTCGTGGGT. External right primer: CAGGATAGCAATTGGGGAGA. Internal left primer: AGTAGGTAGGGGGCAAGCAA. Internal right primer: CTTTGTTCGAAATTTTCCGC. Internal WT amplicon: 1278 bp. Deletion size: 371 bp. Deletion left flank: TCTTACCACTGCTGGATACAAATTGTGATG. Deletion right flank: CTTGAAATTCCAAATTCGGAAAAAAATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807