| PHX3238 |
C. elegans |
nlp-42(syb3238[nlp-42::T2A::3XNLS::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX3240 |
C. elegans |
nlp-1(syb3240[nlp-1::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3241 |
C. elegans |
flp-20 (syb3241 [flp-20::T2A::3xNLS::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-20 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.
|
|
| PHX3242 |
C. elegans |
flp-23(syb3242[flp-23::T2A::3xNLS::GFP]) III. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| PHX3250 |
C. elegans |
capa-1(syb3250[capa-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3251 |
C. elegans |
flp-16(syb3251[flp-16::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3252 |
C. elegans |
unc-10(syb2898 syb3252[unc-10::T2A::3xNLS::GFP]) X. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous unc-10 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| PHX3257 |
C. elegans |
flp-34(syb3257[flp-34::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3258 |
C. elegans |
nhr-49(syb3258[nhr-49::GFP]) I. Show Description
GFP tag inserted at C-terminus of endogenous nhr-49 locus. Reference: Ruiz M, et al. Nat Commun. 2022 Nov 22;13(1):7162. doi: 10.1038/s41467-022-34931-0. PMID: 36418331.
|
|
| PHX3262 |
C. elegans |
nlp-47(syb3262[nlp-47::T2A::3XNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3275 |
C. elegans |
pdf-2(syb3275[pdf-2::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. pdf-2 also known as nlp-37. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3277 |
C. elegans |
flp-13 (syb3277 [flp-13::T2A::3XNLS::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-13 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3278 |
C. elegans |
flp-19(syb3278 [flp-19::T2A::3xNLS::GFP]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| PHX3285 |
C. elegans |
nlp-54(syb3285 [nlp-54::T2A::3xNLS::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-54 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3288 |
C. elegans |
nlp-23(syb3288[nlp-23::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3293 |
C. elegans |
bli-2(syb3293[bli-2::mNG]) II. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-2 locus. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
|
|
| PHX3301 |
C. elegans |
flp-22(syb3301[flp-22::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3306 |
C. elegans |
nlp-62(syb3306[nlp-62::T2A::3XNLS::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-62 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3311 |
C. elegans |
casy-1(syb3311[casy-1::gfp11x7]) II. Show Description
syb3311 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous casy-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Split-GFP tag inserted into endogenous casy-1 locus using CRISPR/Cas9 with two guide RNAs simultaneously. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
|
|
| PHX3312 |
C. elegans |
dpy-5::mNG(syb3312) I. Show Description
mNG inserted at C-terminus of endogenous dpy-5 locus.
|
|
| PHX3317 |
C. elegans |
flp-11b(syb3317[flp-11b::T2A::3XNLS::GFP]) X Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| PHX3318 |
C. elegans |
dpy-13::mNG(syb3318) IV. Show Description
mNG inserted at C-terminus of endogenous dpy-13 locus.
|
|
| PHX3319 |
C. elegans |
nlp-22(syb3319[nlp-22::T2A::3×NLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3320 |
C. elegans |
nlp-49(syb3320[nlp-49::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| PHX3321 |
C. elegans |
ntc-1(syb3321[ntc-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3323 |
C. elegans |
flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. Show Description
Endogenous flp-14 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| PHX3330 |
C. elegans |
pdf-1(syb3330[pdf-1::T2A::3xNLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3334 |
C. elegans |
flp-24(syb3334[flp-24::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3364 |
C. elegans |
eif-2D(syb3364[eif-2D::GFPnovo2::3xFLAG]) II. Show Description
Endogenous eif-2D locus tagged with GFPnovo2 and 3xFLAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|
| PHX3372 |
C. elegans |
rgba-1(syb3372[rgba-1::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3373 |
C. elegans |
nlp-70(syb3373[nlp-70::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3384 |
C. elegans |
nlp-64(syb3384[nlp-64::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3388 |
C. elegans |
nlp-38(syb3388[nlp-38::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3411 |
C. elegans |
nlp-13(syb3411[nlp-13::T2A::3xNLS::GFP]) V. Show Description
Endogenous nlp-13 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| PHX3426 |
C. elegans |
ceh-27(syb2714[loxP] syb3286[loxP] syb3426[ceh27::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX3432 |
C. elegans |
eif-2D(syb3432[(delta)SUI1 domain +3xFLAG]) II. Show Description
Endogenous eif-2D locus tagged with 3xFLAG. The SUI1 domain of the endogenous EIF-2D locus has been deleted and replaced with 3xFLAG via CRISPR/Cas9 gene editing. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|
| PHX3436 |
C. elegans |
flp-4(syb3436[flp-4::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3588 |
C. elegans |
flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X. Show Description
Endogenous flp-26 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| PHX3596 |
C. elegans |
tph-1(mg280) pah-1(syb3596) II. Show Description
Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
|
|
| PHX3601 |
C elegans |
pah-1(syb3601) II. Show Description
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
|
|
| PHX362 |
C. elegans |
vglu-2(syb362[vglu-2::gfp]) III. Show Description
GFP tag inserted into C-terminus of endogenous vglu-2 locus. Reference: Serrano-Saiz E, et al. Genetics. 2019 Nov 27. pii: genetics.302855.2019. PMID: 31776169
|
|
| PHX3634 |
C elegans |
pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. Show Description
Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
|
|
| PHX3678 |
C elegans |
tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. Show Description
GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
|
|
| PHX3685 |
C. elegans |
dpy-17(syb3685[dpy-17::mNG]) III. Show Description
mNeonGreen tag inserted at C-terminus of endogenous dpy-17 locus. GGATACAGAAACTAA -> GGATACAGAAAC^TAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
| PHX3691 |
C. elegans |
sqt-3(syb3691[sqt-3::mNG(int)]) V. Show Description
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
| PHX3936 |
C. elegans |
nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
|
|
| PJ1145 |
C. elegans |
ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Slight Egl.
|
|
| PJ1166 |
C. elegans |
daf-2(m41) III; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Arrest as dauers at 25C. Maintain at 15C.
|
|
| PJ1182 |
C. elegans |
unc-43(n498) IV; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function. Progressive paralysis.
|
|
| PJ1305 |
C. elegans |
unc-43(n498j038) IV; ccIs55; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function suppressed; not markedly small. Egl-d. Lethal @ 25C; short L1's do not survive. No GFP expression.
|
|
