Search Strains

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7180 and CGC66. hd7180 is a 1876 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCTTTTTACAGATTTAATAACACCAAAT; Right flanking sequence: TGGCTACAAATACCTTGAAATTGTTATTCG. sgRNA #1: GGCCCAATACGCCCTGGAGG; sgRNA #2: GACATGCTCTCTAATCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7181 and CGC66. hd7181 is a 1382 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACTTCCTGCACCCAGAACTCATCAATTCCA; Right flanking sequence: AGCCATGCTAGAATTTCCTTTGGGTCCCCA. sgRNA #1: TCACTACTATTTACTCCACG; sgRNA #2: GGAAGTCTTGCATTAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ homozygotes and paralysed DpyUnc mKate2+ mnC1 homozygotes. Derived from parental strains VH7182 and CGC48. hd7182 is a 1757 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCACAACTCTGTGGAATATCCATTTCAC; Right flanking sequence: ATAGCTTCTTCGCTTATTTTTCCAGACATC. sgRNA #1: ACGCTCGAATCGCAAACTGG; sgRNA #2: GCAGGAACAGGCCGAAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7195 and CGC63. hd7195 is a 2300 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAACTCTTTTTCCACCCGGAAAGCATTCCA; Right flanking sequence: AAAATATTGAATTTAAATATTTAAATGTTA. sgRNA #1: GAAGAACAACAAGGACTTAC; sgRNA #2: CAGGGAAATGACAAACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7196 and CGC92. hd7196 is a 1856 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TACGCTAATGCAAAGATCTACAGATGTTCT; Right flanking sequence: AGGAAGAGTTACTGCTGTGAAGGGAGACGC. sgRNA #1: AACCAAGAGTGCCCAAGGCC; sgRNA #2: ATTGGATCGTTGTCAACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7202 and CGC63. hd7202 is a 541 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTAAAAACAATGGTTCAAGGAAAGCTCAAG; Right flanking sequence: TTGATGCTCTTTTGTTACGAACTTTATACC. sgRNA #1: CAAAAGACAGCCTTGCCAAA; sgRNA #2: AAAAGTGATTTCGTAGGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7205 and CGC63. hd7205 is a 672 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GACTCGAACTCAATTTGCATGTTGATAGTT; Right flanking sequence: TGGTTAGAAAAAGATACGGAGAGGAGAAGT. sgRNA #1: CCAATGTTAAAGAAAGTCTT; sgRNA #2: AAACTCTCTTATAGCACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

vkIs2749 [nhx-2p::lmp-1::CemOrange2 + nhx-2p::GFP::ATZ + nhx-2p::mKate2::lgg-1 + myo-2p::GFP + myo-2p::mCherry]. Wild-type animals expressing LMP-1::CemOrange2, GFP::ATZ, and mKate2::LGG-1 under the intestinal-specific nhx-2 promoter. Integrated; chromosomes unknown. Reference: Thomas

vkEx3160 [nhx-2p::abt-4::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain.

vkEx3161 [nhx-2p::abt-4(L162P)::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4(L162P)::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain.

vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663.

vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. GFP aggregation in intestine. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663.

vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. Stronger GFP expression in intestine than in wild-type background. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663.