| BC14605 |
C. elegans |
dpy-5(e907) I; sEx14605. Show Description
sEx14605 [rCes F45H10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14610 |
C. elegans |
dpy-5(e907) I; sEx14610. Show Description
sEx14610 [rCesC46H11.11b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14694 |
C. elegans |
dpy-5(e907) I; sEx14694. Show Description
sEx14694 [rCesC17H12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14720 |
C. elegans |
dpy-5(e907) I; sEx14720. Show Description
sEx14720 [rCesF56H11.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14750 |
C. elegans |
dpy-5(e907) I; sEx14750. Show Description
sEx14750 [rCesC50H11.2 + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14751 |
C. elegans |
dpy-5(e907) I; sEx14751. Show Description
sEx14751[rCesC50H11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14757 |
C. elegans |
dpy-5(e907) I; sEx14757. Show Description
sEx14757 [rCes H12I19.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC15026 |
C. elegans |
dpy-5(e907) I; sEx15026. Show Description
sEx15026 [rCesF56H11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC15297 |
C. elegans |
dpy-5(e907) I; sEx15297. Show Description
sEx15297 [rCesT24H10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC15588 |
C. elegans |
dpy-5(e907) I; sEx15588. Show Description
sEx15588 [rCes C17H12.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16317 |
C. elegans |
dpy-5(e907) I; sEx16317. Show Description
sEx16317 [rCes F13H10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16358 |
C. elegans |
dpy-5(e907) I; sEx16358. Show Description
sEx16358 [rCes C15H11.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16367 |
C. elegans |
dpy-5(e907) I; sEx16367. Show Description
sEx16367 [rCes F39H11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC5127 |
C. elegans |
sEx275. Show Description
sEx275 [C31H11 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 1. 10 ng/ul mini-prepped C31H11 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
| BC5206 |
C. elegans |
sEx317. Show Description
sEx317 [F21H11 (III) + pCes1943[rol-6(su1006)]]. 10.0 ng/ul F21H11 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
| BC5267 |
C. elegans |
sEx345. Show Description
sEx345 [F13H10 (IV) + pCes1943[rol-6(su1006)]]. 20 ng/ul F13H10 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
| BC5480 |
C. elegans |
sEx531. Show Description
sEx531 [K01H12 (IV) + pCes1943[rol-6(su1006)]]. "low" ng/ul K01H12 + 83 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
| BC5705 |
C. elegans |
sEx719. Show Description
sEx719 [F20H11 (III) + pCes1943[rol-6(su1006)]]. segrgnt 2. 15 ng/ul F20H11 + 85 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
| CB3911 |
C. elegans |
dpy-27(rh18) III; 4A;3X. Show Description
Non-Dpy 4A;3X hermaphrodites segregating 4A;3X hermaphrodites, 4A;2X males and dead or very dumpy 4A;4X hermaphrodites. Reference: Strain 19 in Hodgkin (2002) PMID: 12399387
|
|
| CB4900 |
C. elegans |
tra-1(rh132) III; eDp6 (III; f). Show Description
Fertile hermaphrodites segregating more fertile hermaphrodites and sterile Class A10 tra-1(rh132) XX homozygotes, which have hermaphrodite non-gonadal anatomy and male gonads; Smg (NMD)-sensitive. Reference: Zarkower et al. (1994) PMID: 7520378
|
|
| CB6129 |
C. elegans |
dpy-27(rh18) III; fem-1(hc17) IV. [4A;3X] Show Description
Temperature-sensitive: Maintain at 15C. Stable, temperature-sensitive tetraploid strain: fertile 4A;3X hermaphrodites and 4A;2X males at 15C; fertile 4A;3X females and feminized sterile 4A;2X males at 25C. Reference: Hodgkin (2002) PMID: 12399387.
|
|
| CH116 |
C. elegans |
hsb-1(cg116) IV. Show Description
Viable and fertile. Deletion of 664 bp, molecular null.
|
|
| CH1179 |
C. elegans |
unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
|
|
| CH118 |
C. elegans |
nid-1(cg118) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer.
|
|
| CH1180 |
C. elegans |
unc-32(e189) emb-9(cg56)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Uncs which arrest in the L1 stage.
|
|
| CH119 |
C. elegans |
nid-1(cg119) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. Molecular null, deletion removes promoter region. Homozygous viable and fertile, fecundity reduced by approximately 30%. nid-1=F54F3.1.
|
|
| CH120 |
C. elegans |
cle-1(cg120) I. Show Description
Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.
|
|
| CH121 |
C. elegans |
dgn-1(cg121)/dpy-6(e14) unc-115(mn481) X. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Ste (and Gon) cg121 homozygotes.
|
|
| CH123 |
C. elegans |
dgn-2(ok209) X. Show Description
Animals appear wild type.
|
|
| CH1315 |
C. elegans |
zmp-1(cg115) III. Show Description
Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
|
|
| CH1445 |
C. elegans |
unc-119(ed3) III; cgEx198. Show Description
cgEx198 [(pJC14) bli-1::GFP + unc-119(+)]. Pick non-Unc to maintain. Transgene rescues bli-1 phenoptype. GFP expression is detectable in late L4-adult.
|
|
| CH1869 |
C. elegans |
dgn-1(cg121) X; cgEx308. Show Description
cgEx308 [dgn-1(+) + dng-1p::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate.
|
|
| CH1878 |
C. elegans |
dgn-2(ok209) dgn-3(tm1092) dgn-1(cg121) X; cgEx308. Show Description
cgEx308 [pJK600/dgn-1(+) + pJK602/dng-1p::GFP + rol-6(su1066)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-2 dgn-3 dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate. Triple mutants resemble dgn-1 single mutants; no overt phenotype caused by dgn-2 dgn-3 mutations.
|
|
| CHS1124 |
C. elegans |
t06e4.7(yum1724) V; y32h12a.1(yum1726) III; y77e11a.16(yum1725) IV; zk6.6(yum1728) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1142 |
C. elegans |
c04c3.6(yum1830) c04c3.7(yum1835) IV; c50h11.13(yum1832) c54e10.3(yum1833) V; t01b11.1(yum1834) IV; zk863.1(yum1831) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1144 |
C. elegans |
npr-40(yum1846) ah9.1(yum1845) ah9.4(yum1848) b0563.6(yum1844) c17h11.1(yum1847) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1240 |
C. elegans |
t01d1.5(yum2470) zk1307.7(yum2471) f59b1.4(yum2472) f18e3.10(yum2473) f07c3.16(yum2474) f45e10.2(yum2475)f59b1.6(yum2476) y32h12a.1(yum2477) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1252 |
C. elegans |
t10h9.1(yum2567) zc443.7(yum2568) y57a10c.10(yum2569) w05h5.1(yum2570) y57a10c.8(yum2571) f38h12.5(yum2572) y57a10c.9(yum2573) dct-12(yum2574) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1275 |
C. elegans |
mgl-1(yum2769) mgl-2(yum2770) mgl-3(yum2771) c30a5.10(yum2772) f35h10.10(yum2773) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1590 |
C. elegans |
c27h5.6(yum2827) c50e3.7(yum2828) y75b8a.34(yum2829) c50e3.9(yum2830) f42a6.1(yum2831) y55h10a.2(yum2832) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CX5000 |
C. elegans |
slt-1(eh15) X. Show Description
slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant.
|
|
| DH10 |
C. elegans |
mus-101(b10) I. Show Description
Temperature sensitive. Embryonic lethal. Gonadogenesis abnormal. Recessive. Maternal effect (m,m). Strict. Does not grow at 20C or 25C.
|
|
| DH1033 |
C. elegans |
sqt-1(sc103) II; bIs1 X. Show Description
bIs1[vit-2::GFP + rol-6(su1006)].
|
|
| DH117 |
C. elegans |
emb-9(b117) III. Show Description
Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C.
|
|
| DH1201 |
C. elegans |
rme-1(b1045) V. Show Description
Viable. Progressive vacuolation of intestine beginning in L4. Endocytosis defects in oocytes and coelomocytes.
|
|
| DH1206 |
C. elegans |
rme-8(b1023) I. Show Description
Temperature sensitive lethal. Maintain at 15C. Endocytosis defects in oocytes (non-ts) and coelomocytes (ts).
|
|
| DH1230 |
C. elegans |
chc-1(b1025) III. Show Description
Temperature sensitive lethal. Endocytosis defective. Maintain at 15C. AKA: rme-3.
|
|
| DH126 |
C. elegans |
zyg-13(b126) IV. Show Description
Temperature sensitive. Maintain at 15C.
|
|
| DH1300 |
C. briggsae |
C. briggsae wild isolate. Show Description
DH subclone of C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years, and has acquired mutations that have not been named or mapped. It is Unc, dauer-defective and ts lethal. Previously called C. briggsae BO. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| DH1336 |
C. elegans |
bIs34. Show Description
bIs34 [rme-8::GFP + rol-6(su1006)].
|
|